G1749185



Basic Information


Item Value
gene id G1749185
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 50646138 ~ 50646392 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2002794
gtacaaatcaaatcaaatgttattggtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacagtgcagtaatatctaacaagtaatctaacaattccccaacaactacctaatacacacaaatctaaaggggtgaatgagaatatgtacatttaagtatatggatgagcgatggtcgagcagcataggcaaggtgcagtagatggtataaaatacattatatac

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2002794 True 255 lncRNA 0.37 1 50646138 50646392

Neighbor


gene id symbol gene type direction distance location
LOC110500655 LOC106608652 coding downstream 93540 50542604 ~ 50552598 (-)
LOC110500654 LOC106608650 coding downstream 103575 50534005 ~ 50542563 (-)
si:ch73-269m23.5 LOC106608694 coding downstream 112259 50531099 ~ 50533879 (-)
larp7 larp7 coding downstream 127916 50508497 ~ 50518222 (-)
LOC110500648 plin2 coding downstream 143876 50497065 ~ 50502262 (-)
LOC110500944 NA coding upstream 305640 50952032 ~ 50978597 (-)
LOC110500666 LOC106608661 coding upstream 335854 50982246 ~ 50992851 (-)
LOC110500667 LOC106608662 coding upstream 349969 50996361 ~ 51002663 (-)
LOC110500668 trmt44 coding upstream 390217 51036609 ~ 51051426 (-)
LOC110500670 LOC106608666 coding upstream 422984 51069376 ~ 51084011 (-)
G1749180 NA non-coding downstream 7269 50638360 ~ 50638869 (-)
G1749178 NA non-coding downstream 12818 50633002 ~ 50633320 (-)
G1749168 NA non-coding downstream 28610 50617327 ~ 50617528 (-)
G1749154 LOC106608695 non-coding downstream 47851 50591563 ~ 50598287 (-)
G1749149 NA non-coding downstream 59502 50586431 ~ 50586636 (-)
G1749223 NA non-coding upstream 60278 50706670 ~ 50708436 (-)
G1749238 hgfa non-coding upstream 85253 50731645 ~ 50732954 (-)
G1749252 NA non-coding upstream 103297 50749689 ~ 50749928 (-)
G1749253 LOC106608658 non-coding upstream 104117 50750509 ~ 50751504 (-)
G1749254 NA non-coding upstream 109109 50755501 ~ 50756604 (-)
G1749122 LOC106608652 other downstream 93613 50542435 ~ 50552525 (-)
G1747934 NA other downstream 1057350 49587696 ~ 49588788 (-)
G1747908 LOC106608618 other downstream 1131974 49512069 ~ 49514164 (-)
LOC110500619 LOC106608618 other downstream 1144211 49493629 ~ 49502064 (-)
G1750625 NA other upstream 590493 51236885 ~ 51237163 (-)
c21h11orf68 cssa07h11orf68 other upstream 839308 51485700 ~ 51501323 (-)
G1751128 NA other upstream 1481606 52127998 ~ 52128318 (-)
LOC110500888 peli3 other upstream 2728277 53370137 ~ 53405755 (-)

Expression



Co-expression Network