G1752969



Basic Information


Item Value
gene id G1752969
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 54748845 ~ 54750853 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2007100
atggtgttgggccagtaaccagcagatagtctagtggttatggtgttgggccagtaaccagcagatagtctagtggttatggtgttgaactagtaaccatgaggtaacctagtggttatggtgttggactagtaaccagcagatagtctagtggttatggtgttgggccagtaaccatgaggtaacctagtggttatggtgttggactagtaaccagcagatagtctagtggttatggtgttgggccagtaaccagcaggtaacctagtggttatggtgttggactagtaacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2007100 True 293 lncRNA 0.46 2 54748845 54750853
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500891 afap1 coding upstream 240568 54349344 ~ 54508277 (+)
LOC110500735 ablim2 coding upstream 406264 54206483 ~ 54342581 (+)
si:dkey-219e21.4 LOC106608570 coding upstream 545943 54199722 ~ 54202902 (+)
LOC110500729 md2l1 coding upstream 678302 54067452 ~ 54070543 (+)
LOC118942947 NA coding upstream 975520 53769687 ~ 53773325 (+)
LOC110500744 grpel1 coding downstream 204694 54955547 ~ 54960002 (+)
ccdc96 ccdc96 coding downstream 215381 54966234 ~ 54968068 (+)
LOC110500741 LOC106595343 coding downstream 231939 54982792 ~ 54986995 (+)
smim20 NA coding downstream 381115 55131968 ~ 55133176 (+)
LOC110500752 NA coding downstream 391371 55142224 ~ 55148988 (+)
G1752942 NA non-coding upstream 43944 54704069 ~ 54704901 (+)
G1752853 NA non-coding upstream 233092 54513627 ~ 54515753 (+)
G1752814 NA non-coding upstream 333802 54414176 ~ 54415043 (+)
G1752798 NA non-coding upstream 387866 54360526 ~ 54360979 (+)
G1752727 NA non-coding upstream 400670 54344087 ~ 54348175 (+)
G1752932 NA non-coding downstream 9596 54760449 ~ 54762436 (+)
G1752975 NA non-coding downstream 13056 54763909 ~ 54765493 (+)
G1752982 NA non-coding downstream 30366 54781219 ~ 54781499 (+)
G1752989 NA non-coding downstream 87436 54838289 ~ 54866200 (+)
G1753023 NA non-coding downstream 111986 54862839 ~ 54911974 (+)
LOC110500722 NA other upstream 1492244 53251413 ~ 53256660 (+)
G1751699 LOC106608599 other upstream 1776462 52962449 ~ 52972383 (+)
G1750050 NA other upstream 2551838 52191200 ~ 52197007 (+)
G1750030 LOC106608688 other upstream 2653740 52094709 ~ 52095105 (+)
G1753100 NA other downstream 250726 55001579 ~ 55011678 (+)
LOC110500754 LOC106591080 other downstream 839752 55590450 ~ 55592100 (+)
G1755158 NA other downstream 1635554 56386407 ~ 56387622 (+)
G1755570 NA other downstream 2042878 56793731 ~ 56794574 (+)
G1756789 NA other downstream 3175627 57926480 ~ 57928244 (+)

Expression


G1752969 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1752969 Expression in each Bioproject

Bar chart with 4 bars.
G1752969 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network