G1755310



Basic Information


Item Value
gene id G1755310
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 56390057 ~ 56390566 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2009879
ggttgatatggttgatatggttgacatggttgatatggttgacatggttgatatggttgacatggttgacatggttgacatggttgatatggttgacatggttgatatggttgatatggttgatatggttgacatggttgatatggttgacatggttgatatggttgatatggttgatatggttgatatggttgacatggttgatatggttgatatggttgacatggttgatatggttgacatggttgatatggttgatatggttgatatggttgatatggttgatatggttgatatggttgacatggttgatatggttgatatggttatggttgatatggttgatatggttgatatggttgacatggttgacatggttgatatggttgatatggttgacatggttgatatggttgatatggttatggttgatatggttgatatggttgatatggttgatatggttgatatggttgacatggttgatatggttgatatggttgatatggt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2009879 True 510 TUCP 0.37 1 56390057 56390566

Neighbor


gene id symbol gene type direction distance location
LOC118942954 NA coding downstream 97382 56291672 ~ 56292747 (-)
LOC118942811 NA coding downstream 159015 56230477 ~ 56231042 (-)
LOC118942810 NA coding downstream 289186 56100143 ~ 56100871 (-)
LOC118942809 NA coding downstream 734984 55654018 ~ 55655073 (-)
LOC118942808 NA coding downstream 799799 55561991 ~ 55590258 (-)
zmp:0000000660 arap2 coding upstream 888942 57279508 ~ 57536784 (-)
rell1 LOC106608524 coding upstream 1514188 57904754 ~ 57959296 (-)
LOC118942957 NA coding upstream 1640445 58029260 ~ 58035943 (-)
paqr9 paqr9 coding upstream 1645932 58036498 ~ 58040363 (-)
LOC110500948 zmynd15 coding upstream 1653090 58043656 ~ 58052984 (-)
G1755307 NA non-coding downstream 1013 56386438 ~ 56389044 (-)
G1755060 NA non-coding downstream 203551 56186230 ~ 56186506 (-)
G1755058 NA non-coding downstream 205274 56184564 ~ 56184783 (-)
G1755045 NA non-coding downstream 217228 56172485 ~ 56172829 (-)
G1755311 NA non-coding upstream 756 56391322 ~ 56391566 (-)
G1755314 NA non-coding upstream 4228 56394794 ~ 56395039 (-)
G1755317 NA non-coding upstream 10000 56400566 ~ 56400824 (-)
G1755319 NA non-coding upstream 12745 56403311 ~ 56403608 (-)
G1755324 NA non-coding upstream 18254 56408820 ~ 56409149 (-)
G1754243 NA other downstream 1116108 55272218 ~ 55273949 (-)
LOC110500749 s100p other downstream 1282476 55106685 ~ 55107622 (-)
LOC110500893 tada2b other downstream 1423952 54961826 ~ 54966157 (-)
G1754055 NA other downstream 1540974 54843065 ~ 54849083 (-)
G1753637 NA other downstream 2357751 54031582 ~ 54032306 (-)
G1755322 NA other upstream 16016 56406582 ~ 56407318 (-)
G1757073 NA other upstream 1511520 57902086 ~ 57902593 (-)
G1757074 NA other upstream 1517573 57908139 ~ 57909134 (-)
G1757130 NA other upstream 1652084 58042650 ~ 58043057 (-)
G1757692 NA other upstream 2409608 58800174 ~ 58805825 (-)

Expression


G1755310 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1755310 Expression in each Bioproject

Bar chart with 9 bars.
G1755310 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network