G1757139



Basic Information


Item Value
gene id G1757139
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 58179911 ~ 58180455 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2011969
TTCAAATCTGTACAGTTATTTCAAAATTCAAAAATATGCATTCAGTTTAACATTCAAAGCCATTCAGTCACTTCAACACATTCAAAGCCATTCAGTCACTTCAACACATTCAAAGCCATTCAGTCACTTCAACACATTCAAAGCCATTCAGTCACTTCAACACATTCAAAGCCATTCAGTCACTTCAACACATTCAAAGCCATTCAGTCACTTCAACACATTCAAAGCCATTCAGTCAGTTCAGTTCAACATTCAAAGCCATTCAGTCAGTTCAGTTCAACATTCAAAGCCATTCAGTCACTTCAACACATTCAAAGCCATTCAGTCAGTTCAGTTCAACATTCAAAGCCATTCAGTCAGTTCAGTTCAACATTCAAAGCCATTCAGTCAGTTCAGTTCAACATTCAAAGCCATTCAGTCAGTTCAGTTCAACATTCAAAGCCATTCAGTCAGTTCAGTTCAACAT

Function


NR:

description
zinc finger protein 257-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2011969 True 466 lncRNA 0.37 2 58179911 58180455

Neighbor


gene id symbol gene type direction distance location
LOC110500946 fbxo24 coding downstream 111578 58056547 ~ 58068333 (-)
LOC110500947 zmynd15 coding downstream 123828 58053125 ~ 58056083 (-)
LOC110500948 zmynd15 coding downstream 126927 58043656 ~ 58052984 (-)
paqr9 paqr9 coding downstream 139548 58036498 ~ 58040363 (-)
LOC118942957 NA coding downstream 143968 58029260 ~ 58035943 (-)
LOC118942959 NA coding upstream 14805 58195260 ~ 58198250 (-)
LOC118942958 NA coding upstream 191695 58372150 ~ 58378475 (-)
LOC110500784 ing2 coding upstream 260712 58441167 ~ 58443946 (-)
LOC110500779 LOC106608532 coding upstream 318804 58499259 ~ 58508480 (-)
LOC110500778 LOC106608531 coding upstream 328121 58508576 ~ 58512400 (-)
G1757169 NA non-coding downstream 68885 58110315 ~ 58111026 (-)
G1757162 NA non-coding downstream 75106 58103826 ~ 58104805 (-)
G1757130 NA non-coding downstream 136854 58042650 ~ 58043057 (-)
G1757127 NA non-coding downstream 154450 58023747 ~ 58025461 (-)
G1757217 NA non-coding upstream 70234 58250689 ~ 58254043 (-)
G1757235 NA non-coding upstream 112530 58292985 ~ 58293391 (-)
G1757246 NA non-coding upstream 141019 58321474 ~ 58322027 (-)
G1757249 NA non-coding upstream 143261 58323716 ~ 58327952 (-)
G1757279 NA non-coding upstream 211237 58391692 ~ 58392526 (-)
G1757074 NA other downstream 270777 57908139 ~ 57909134 (-)
G1757073 NA other downstream 277318 57902086 ~ 57902593 (-)
G1755322 NA other downstream 1772593 56406582 ~ 56407318 (-)
G1755310 NA other downstream 1789345 56390057 ~ 56390566 (-)
G1757692 NA other upstream 619719 58800174 ~ 58805825 (-)
G1758095 NA other upstream 1011977 59192432 ~ 59195490 (-)
G1758845 NA other upstream 1843312 60023767 ~ 60024903 (-)
G1758890 NA other upstream 1942087 60122542 ~ 60123364 (-)
G1758915 NA other upstream 2007955 60188410 ~ 60225587 (-)

Expression


G1757139 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1757139 Expression in each Bioproject

Bar chart with 18 bars.
G1757139 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network