G1757723



Basic Information


Item Value
gene id G1757723
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 58825105 ~ 58825309 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2012624
aactgtaataaaagtccccatgatggtagtgactgtaataaaagtccccgtgatggtagtgactgtaataaaagtccccatgatggtagtgactgtaataaaagtccccatgatggtagtgactgtaataaaagtccccatgatggtagtgactgtaataaaagtccccatgatggtagtgactgtaataaaagtccccgtgatg

Function


NR:

description
PREDICTED: eukaryotic translation initiation factor 3 subunit A isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2012624 True 205 lncRNA 0.40 1 58825105 58825309

Neighbor


gene id symbol gene type direction distance location
LOC110500780 caap1 coding upstream 301475 58512708 ~ 58523630 (+)
si:ch211-212k18.7 cd68 coding upstream 360921 58456696 ~ 58464184 (+)
LOC110500903 LOC106608527 coding upstream 383834 58411942 ~ 58441271 (+)
rwdd rwdd4 coding upstream 413379 58405236 ~ 58411726 (+)
lrch4 lrch4 coding upstream 683987 58084350 ~ 58141118 (+)
elavl2 elavl2 coding downstream 25774 58851083 ~ 58904451 (+)
LOC110500773 LOC106608508 coding downstream 518299 59343608 ~ 59348145 (+)
LOC110500769 LOC106608502 coding downstream 638284 59463593 ~ 59514503 (+)
LOC118942960 NA coding downstream 668180 59493489 ~ 59498544 (+)
trnar-ucu-10 NA coding downstream 691112 59516421 ~ 59516493 (+)
G1757720 NA non-coding upstream 1700 58823014 ~ 58823405 (+)
G1757608 NA non-coding upstream 117661 58707205 ~ 58707444 (+)
G1757581 NA non-coding upstream 132925 58690697 ~ 58692180 (+)
G1757574 NA non-coding upstream 150714 58673958 ~ 58674391 (+)
G1757573 NA non-coding upstream 151207 58673626 ~ 58673898 (+)
G1757726 NA non-coding downstream 2721 58828030 ~ 58896868 (+)
G1757813 NA non-coding downstream 96322 58921631 ~ 58922153 (+)
G1757941 NA non-coding downstream 347552 59172861 ~ 59178684 (+)
G1757943 NA non-coding downstream 348373 59173682 ~ 59174262 (+)
G1757945 NA non-coding downstream 362025 59187334 ~ 59188240 (+)
G1757578 NA other upstream 138582 58683137 ~ 58686523 (+)
G1756789 NA other upstream 896861 57926480 ~ 57928244 (+)
G1755570 NA other upstream 2030531 56793731 ~ 56794574 (+)
G1755158 NA other upstream 2437483 56386407 ~ 56387622 (+)
G1758801 NA other downstream 1496906 60322215 ~ 60326620 (+)
G1758818 NA other downstream 1526337 60351646 ~ 60353092 (+)
G1758786 NA other downstream 1533521 60358349 ~ 60359351 (+)
G1759168 LOC101154678 other downstream 1896849 60722158 ~ 60722472 (+)
G1759267 NA other downstream 1984893 60810202 ~ 60810620 (+)

Expression


G1757723 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1757723 Expression in each Bioproject

Bar chart with 15 bars.
G1757723 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network