G1759174



Basic Information


Item Value
gene id G1759174
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 60570325 ~ 60570655 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2014445
ctgttctgatagactactgttggatgtgttctggagttctgttctgatagactactgttggatgtgttctggagttctgttctgatagactactgttgaatgtgttctggagttctgttctgatagactactgttgaatgtgttctggagttctgttctgatagactactgttgaatgtgttctggagttctgttctgatagactactgttgaatgtgttctggagttctgttctgatagactactgttgaatgtgttctggagttctgttctagtctgatagactactgttggatgtgttctggagttctgttctgatagactactgttg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2014445 True 331 lncRNA 0.40 1 60570325 60570655

Neighbor


gene id symbol gene type direction distance location
LOC110500514 LOC106608822 coding downstream 49686 60509429 ~ 60520639 (-)
LOC118942962 LOC106608456 coding downstream 200260 60352810 ~ 60370197 (-)
LOC110500796 LOC106608455 coding downstream 227163 60333055 ~ 60343162 (-)
LOC118943008 NA coding downstream 249354 60320864 ~ 60320971 (-)
trnay-gua-326 NA coding downstream 396382 60173857 ~ 60173943 (-)
LOC110510457 LOC106608459 coding upstream 491446 60994704 ~ 61130268 (-)
LOC110510459 LOC106560462 coding upstream 508865 61079520 ~ 61128336 (-)
tkfc tkfc coding upstream 580797 61151452 ~ 61181374 (-)
LOC110500799 LOC106608443 coding upstream 1015564 61586219 ~ 61694778 (-)
LOC110532858 LOC106592087 coding upstream 1256810 61827465 ~ 61901799 (-)
G1759117 NA non-coding downstream 18262 60551864 ~ 60552063 (-)
G1759112 NA non-coding downstream 22309 60547698 ~ 60548016 (-)
G1759098 NA non-coding downstream 48187 60521938 ~ 60522138 (-)
G1759097 NA non-coding downstream 48523 60521506 ~ 60521802 (-)
G1759089 NA non-coding downstream 61014 60506678 ~ 60509311 (-)
G1759175 NA non-coding upstream 15245 60585900 ~ 60586159 (-)
G1759176 NA non-coding upstream 18978 60589633 ~ 60589885 (-)
G1759191 NA non-coding upstream 32174 60602829 ~ 60603139 (-)
G1759193 NA non-coding upstream 39145 60609800 ~ 60610015 (-)
G1759194 NA non-coding upstream 40253 60610908 ~ 60611131 (-)
G1759103 NA other downstream 41535 60528387 ~ 60528790 (-)
G1758915 NA other downstream 344738 60188410 ~ 60225587 (-)
G1758890 NA other downstream 446961 60122542 ~ 60123364 (-)
G1758845 NA other downstream 545422 60023767 ~ 60024903 (-)
G1759186 NA other upstream 81305 60651960 ~ 60652756 (-)
G1759503 NA other upstream 353741 60924396 ~ 60938917 (-)
G1759527 NA other upstream 418113 60988768 ~ 60989247 (-)
zgc:77880 LOC106608439 other upstream 1433276 62003931 ~ 62034694 (-)

Expression


G1759174 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1759174 Expression in each Bioproject

Bar chart with 11 bars.
G1759174 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network