G1759154


Basic Information

Item Value
gene id G1759154
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 60689568 ~ 60691088 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2014420
atcatgttgttgtatataactgacagtaatacacagtggaaccatcatcatgttgttgtatataactgacagtaatacacagtggaaccatcatcatgttgttgtatataactgacagtaatacacagtggaaccatcatcatgttgtatataactgacagtaatacacagtggaaccatcatcatgttgttgtatataactgacagtaatacacagtggaatcatcatcatgttgttgtatataactgacagtaatacacagtggaaccatcatcatgttgtatataactgacagtaatacacagtggaaccatcatcatgttgttgtatataactgacagtaatacacagtggaaccatcatcatgttgttgtatataactgacagtaatacacagtggaaccatcatcatgttgtatataactgacagtaatcgagagagctggggagagagagagtgtgagagagaggtggggagagagagagtgtaagagagaggtg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2014420 True 502 lncRNA 0.37 2 60689568 60691088
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110500798 LOC106608478 coding upstream 35462 60632412 ~ 60654106 (+)
LOC110500797 4f2 coding upstream 60311 60613390 ~ 60629257 (+)
LOC118943030 NA coding upstream 369858 60319603 ~ 60319710 (+)
LOC118942814 LOC106578145 coding upstream 381663 60284625 ~ 60307905 (+)
LOC110500950 LOC106608479 coding upstream 416760 60257181 ~ 60272808 (+)
LOC118942965 NA coding downstream 57918 60749006 ~ 60774137 (+)
LOC118942966 NA coding downstream 87471 60778559 ~ 60779842 (+)
LOC118942963 NA coding downstream 111305 60802393 ~ 60803538 (+)
LOC118942964 NA coding downstream 117397 60808485 ~ 60809684 (+)
LOC110500905 LOC106608450 coding downstream 209689 60900777 ~ 60924091 (+)
G1759153 NA non-coding upstream 2617 60686521 ~ 60686951 (+)
G1759149 LOC106582599 non-coding upstream 7870 60681277 ~ 60681698 (+)
G1759148 NA non-coding upstream 8365 60680996 ~ 60681203 (+)
G1759147 NA non-coding upstream 9114 60680146 ~ 60680454 (+)
G1759144 NA non-coding upstream 12993 60668403 ~ 60676575 (+)
G1759157 NA non-coding downstream 2675 60693763 ~ 60694026 (+)
G1759159 NA non-coding downstream 9741 60700829 ~ 60701086 (+)
G1759161 NA non-coding downstream 16532 60707620 ~ 60712578 (+)
G1759166 NA non-coding downstream 28604 60719692 ~ 60719944 (+)
G1759167 NA non-coding downstream 30191 60721279 ~ 60721766 (+)
G1758786 NA other upstream 330217 60358349 ~ 60359351 (+)
G1758818 NA other upstream 336534 60351646 ~ 60353092 (+)
G1758801 NA other upstream 362948 60322215 ~ 60326620 (+)
G1757578 NA other upstream 2003045 58683137 ~ 58686523 (+)
rwdd rwdd4 other upstream 2279489 58405236 ~ 58411726 (+)
G1759168 LOC101154678 other downstream 31070 60722158 ~ 60722472 (+)
G1759267 NA other downstream 119114 60810202 ~ 60810620 (+)
G1760504 NA other downstream 2043963 62689513 ~ 62741819 (+)
G1760587 NA other downstream 2120687 62811775 ~ 62814241 (+)
LOC110500953 LOC106594432 other downstream 2182593 62873681 ~ 62903536 (+)

Expression

G1759154 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1759154 Expression in each Bioproject

Bar chart with 12 bars.
G1759154 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network