G1760327



Basic Information


Item Value
gene id G1760327
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 62318535 ~ 62319504 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2016095
ATGCCAGTAGGAGTCAAGGCTGTGCTGGCCATGCCAGCAGGAGTCAAGGCTGTGCTGGCCATGCCAGTAGGAGTCAAGGCTGTGCTGGCCATGCCAGTAGGGTGAAGGCTGTGCTGGTCATGCCAGTAGGAGTCAAGGCTGTGCTGGCCATGCCAGTAGGAGTCAAGGCTGTGCTGGCAATGCCAGTAGGAGTCAAGGCTGAGCTGGCCATGCCAGTAGGAGTCAAGGCTGTGCTGGCCATGCCAGTAGGAGTCAAGGCTGTGCTGGCCATGCCAGTAGGAGT

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2016095 True 283 TUCP 0.59 2 62318535 62319504
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536443 LOC106613451 coding downstream 53497 62250969 ~ 62265038 (-)
lratb.1 LOC106608435 coding downstream 102784 62154968 ~ 62227545 (-)
LOC110500951 LOC106578168 coding downstream 188156 62120367 ~ 62130379 (-)
zgc:77880 LOC106608439 coding downstream 283841 62003931 ~ 62034694 (-)
tlr2 LOC106608430 coding upstream 7120 62326624 ~ 62354302 (-)
trim2b LOC106578174 coding upstream 43052 62360390 ~ 62394951 (-)
LOC110514818 LOC106594788 coding upstream 168387 62487891 ~ 62548349 (-)
LOC118942974 NA coding upstream 318637 62638141 ~ 62643647 (-)
LOC110500823 LOC106608424 coding upstream 327092 62646596 ~ 62674079 (-)
G1760326 NA non-coding downstream 4846 62312813 ~ 62313689 (-)
G1760213 NA non-coding downstream 6150 62311524 ~ 62312385 (-)
G1760325 NA non-coding downstream 7097 62305638 ~ 62311438 (-)
G1760324 NA non-coding downstream 13695 62304619 ~ 62304840 (-)
G1760319 NA non-coding downstream 20888 62296931 ~ 62297647 (-)
G1760329 NA non-coding upstream 4319 62323823 ~ 62325742 (-)
G1760333 NA non-coding upstream 25844 62345348 ~ 62345755 (-)
G1760338 NA non-coding upstream 37388 62356892 ~ 62359478 (-)
G1760347 NA non-coding upstream 75770 62395274 ~ 62395537 (-)
G1760302 NA other downstream 68298 62248367 ~ 62250237 (-)
LOC110532858 LOC106592087 other downstream 416904 61827465 ~ 61901799 (-)
LOC110500819 LOC106608419 other upstream 520230 62813988 ~ 62854106 (-)
G1761295 NA other upstream 690683 63010187 ~ 63010660 (-)
G1761302 NA other upstream 730968 63050472 ~ 63053663 (-)
camta2 camta2 other upstream 1202102 63434675 ~ 63562110 (-)
LOC118942979 NA other upstream 1222988 63542492 ~ 63629859 (-)

Expression


G1760327 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1760327 Expression in each Bioproject

Bar chart with 12 bars.
G1760327 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network