G1761486


Basic Information

Item Value
gene id G1761486
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 63428942 ~ 63430117 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2017709
atctctgataccattactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctgcaggtattgatcctgcaggtctctagctgataccattactaccaggtattg
>TU2017710
atctctgataccattactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctacaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgatacctgtactaccaggtattgatcctacaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctac
>TU2017711
atctctgataccattactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgatacctttactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtattgatcctgcaggtcatctctgataccattactaccaggtactgatcctgcaggtcatctctgatac

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2017709 False 209 lncRNA 0.44 2 63428942 63430117
TU2017710 False 487 lncRNA 0.43 2 63429059 63430117
TU2017711 True 380 lncRNA 0.44 2 63429410 63430117
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118942977 NA coding downstream 113961 63312403 ~ 63314981 (-)
LOC110500810 NA coding downstream 183438 63241114 ~ 63245504 (-)
asgrl2 LOC106591604 coding downstream 489437 62921176 ~ 62939505 (-)
LOC110500819 LOC106608419 coding downstream 574836 62813988 ~ 62854106 (-)
trnah-gug-110 NA coding downstream 682271 62746600 ~ 62746671 (-)
camta2 camta2 coding upstream 4558 63434675 ~ 63562110 (-)
si:ch1073-157b13.1 LOC106608406 coding upstream 148805 63578922 ~ 63607637 (-)
LOC118942979 NA coding upstream 196222 63542492 ~ 63629859 (-)
LOC110498011 LOC106608403 coding upstream 393093 63823210 ~ 63832447 (-)
LOC118942816 LOC106608393 coding upstream 657069 64087186 ~ 64089298 (-)
G1761483 NA non-coding downstream 5034 63423244 ~ 63423908 (-)
G1761479 NA non-coding downstream 9899 63416555 ~ 63419043 (-)
G1761466 NA non-coding downstream 30462 63397888 ~ 63398480 (-)
G1761453 NA non-coding downstream 73408 63351244 ~ 63355534 (-)
G1761420 LOC100196671 non-coding downstream 85325 63307595 ~ 63343617 (-)
G1761487 NA non-coding upstream 235 63430352 ~ 63430572 (-)
G1761467 NA non-coding upstream 1793 63431910 ~ 63434485 (-)
G1761490 NA non-coding upstream 26780 63456897 ~ 63457140 (-)
G1761491 NA non-coding upstream 27118 63457235 ~ 63458163 (-)
G1761494 NA non-coding upstream 31702 63461819 ~ 63462617 (-)
G1761302 NA other downstream 375279 63050472 ~ 63053663 (-)
G1761295 NA other downstream 418282 63010187 ~ 63010660 (-)
G1760327 NA other downstream 1109438 62318535 ~ 62319504 (-)
G1760325 NA other downstream 1120716 62305638 ~ 62311438 (-)
LOC110517683 LOC106592125 other upstream 775260 64205352 ~ 64223639 (-)
G1761826 NA other upstream 987193 64417310 ~ 64418052 (-)

Expression

G1761486 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1761486 Expression in each Bioproject

Bar chart with 12 bars.
G1761486 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.

Co-expression Network