G1761733


Basic Information

Item Value
gene id G1761733
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 64111526 ~ 64114472 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2018094
gaccccaggaagagtagctgctacatgttaatggaccccaggaagagtagatgctacgtgttcagtagttaatggaccccaggaagagttactgctgcatgttcagtagttaatggaccccaggaagagtagctgctacatgttcagtagttaatggaccccaggaagagtagctgctacatgttcagtagttaatggaccccaggaagagtagctgctacatgttaatggaccccaggaagagtagctgctacatgtgcagtagttaatggaccccaggaagagtagctgctgcatgttcagtagttaatggaccccaggaagagtagctgctacatgttcagtagttaatggaccccaggaagagaagctgctacatgttcagtagttaatggaccccaggtagagtagctgctacatgttcagtagttattggaccctaggaagagtagctgctacatgttcagtagttaatggatcccaggaagagtagctgctacatgttcagtagttaatggaccccaggaagagtagctgctacatgttcagtagttaatggaccccaggaagagtagctgctgcatgttcagtagttaatggaccccaggtagagtagctgctacatgttcagtagttaatggaccccaggtagagtagctgctacatgttcagtagttaatggaccccaggaagagtagctgctacatgttcagtagttaatggaccccaggtagagtagctgctacatgttcagtagttaatggaccccaggaagagtagctgctacatgttcagtagttattggaccccaggtagagtagctgctacatgttcagtagttaatggaccccaggtagagtagctgctacatgttaatggaccccaggaagagtagctgctacatgt

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2018094 True 906 lncRNA 0.47 3 64111526 64114472
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118942816 LOC106608393 coding downstream 22228 64087186 ~ 64089298 (-)
LOC110498011 LOC106608403 coding downstream 279079 63823210 ~ 63832447 (-)
LOC118942979 NA coding downstream 481667 63542492 ~ 63629859 (-)
si:ch1073-157b13.1 LOC106608406 coding downstream 503889 63578922 ~ 63607637 (-)
camta2 camta2 coding downstream 549416 63434675 ~ 63562110 (-)
LOC110509411 LOC106562799 coding upstream 33582 64148054 ~ 64176432 (-)
LOC110517683 LOC106592125 coding upstream 90880 64205352 ~ 64223639 (-)
corin corin coding upstream 123060 64237532 ~ 64381441 (-)
nfxl1 nfxl1 coding upstream 270444 64384916 ~ 64480987 (-)
LOC118942981 NA coding upstream 272089 64386561 ~ 64387808 (-)
G1761711 NA non-coding downstream 1462 64063585 ~ 64110064 (-)
G1761730 NA non-coding downstream 8929 64101829 ~ 64102597 (-)
G1761710 NA non-coding downstream 50619 64060480 ~ 64060907 (-)
G1761709 NA non-coding downstream 51129 64059108 ~ 64060397 (-)
G1761691 NA non-coding downstream 140747 63969564 ~ 63970779 (-)
G1761754 NA non-coding upstream 64938 64179410 ~ 64182948 (-)
G1761753 NA non-coding upstream 66233 64180705 ~ 64181672 (-)
G1761772 NA non-coding upstream 92488 64206960 ~ 64209216 (-)
G1761766 NA non-coding upstream 119494 64233966 ~ 64236453 (-)
G1761783 NA non-coding upstream 166978 64281450 ~ 64283850 (-)
G1761302 NA other downstream 1057863 63050472 ~ 63053663 (-)
G1761295 NA other downstream 1100866 63010187 ~ 63010660 (-)
G1761826 NA other upstream 302838 64417310 ~ 64418052 (-)
LOC110509409 LOC106593257 other upstream 476135 64590607 ~ 64647805 (-)
G1762080 NA other upstream 634032 64748504 ~ 64749274 (-)
G1762085 NA other upstream 639235 64753707 ~ 64754499 (-)

Expression

G1761733 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1761733 Expression in each Bioproject

Bar chart with 15 bars.
G1761733 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network