G1761822



Basic Information


Item Value
gene id G1761822
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 64405871 ~ 64406337 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2018231
GCGATAGGTTAAACAGCTGTGAAGGAGCGATAGGTTAAACAGCTGTGAAGGAGCGATAGGATCAACAGCTGTGAAGGAGCGATAGGATCAACAGCTGTGAAGGAGCGATAGGATAAACAGCTGTGAAGGAGCGATAGGATCAACAGCTGTGAAGGAGCGATAGGATAAACAGCTGTGAAGGAGCGATAGGATAAACAGCTGTGAAGGAGCGATAGGATCAACAGCTGTGAAGGAGCGATAGGATCAACAGCTGTGAAGGAGCGATAGGATCAACAGCTGTGAAGGAGCGATAGGATCAACAGCTGTGAAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2018231 True 311 lncRNA 0.49 2 64405871 64406337

Neighbor


gene id symbol gene type direction distance location
LOC118942981 NA coding downstream 18063 64386561 ~ 64387808 (-)
corin corin coding downstream 24430 64237532 ~ 64381441 (-)
LOC110517683 LOC106592125 coding downstream 182232 64205352 ~ 64223639 (-)
LOC110509411 LOC106562799 coding downstream 229439 64148054 ~ 64176432 (-)
LOC110510319 NA coding downstream 281052 64100432 ~ 64124819 (-)
cnga1b cnga1 coding upstream 77185 64483522 ~ 64518038 (-)
LOC118942817 LOC106608410 coding upstream 119560 64525897 ~ 64533370 (-)
LOC110509409 LOC106593257 coding upstream 185419 64590607 ~ 64647805 (-)
LOC118942818 LOC106608414 coding upstream 307485 64663711 ~ 64723784 (-)
LOC118942984 LOC106592811 coding upstream 370229 64776566 ~ 64790358 (-)
G1761818 NA non-coding downstream 5707 64399506 ~ 64400164 (-)
G1761814 NA non-coding downstream 26519 64378446 ~ 64379352 (-)
G1761792 NA non-coding downstream 87654 64317834 ~ 64318217 (-)
G1761790 NA non-coding downstream 91493 64313774 ~ 64314378 (-)
G1761830 NA non-coding upstream 20637 64426974 ~ 64430355 (-)
G1761796 NA non-coding upstream 55668 64462005 ~ 64463656 (-)
G1761930 NA non-coding upstream 95691 64502028 ~ 64516323 (-)
G1761942 NA non-coding upstream 140893 64547230 ~ 64553749 (-)
G1761943 NA non-coding upstream 145890 64552227 ~ 64552992 (-)
LOC110498011 LOC106608403 other downstream 573477 63823210 ~ 63832447 (-)
LOC118942979 NA other downstream 776024 63542492 ~ 63629859 (-)
camta2 camta2 other downstream 843818 63434675 ~ 63562110 (-)
G1761302 NA other downstream 1352208 63050472 ~ 63053663 (-)
G1761826 NA other upstream 10973 64417310 ~ 64418052 (-)
G1762080 NA other upstream 342167 64748504 ~ 64749274 (-)
G1762085 NA other upstream 347370 64753707 ~ 64754499 (-)
G1762162 NA other upstream 450171 64856508 ~ 64857185 (-)

Expression


G1761822 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1761822 Expression in each Bioproject

Bar chart with 17 bars.
G1761822 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network