XLOC_036982


Basic Information

Item Value
gene id XLOC_036982
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 10562638 ~ 10564946 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00074886
atttattagagcagctgtcgatgtgggcaggtgttcataaaacgtgattttaatagtttggcgtgactcctttttcattgcccgggatttagcaggcagacgcagcttctgcaatggtcgacattaactgctcccagcagcggatctgattaacacgataccaaagtgattttgttacctgtggatcttcaaacttcacatccagagttgtgaggaatcagaggtgcatgcggctgcccacgggaaaaatttgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttgagatatattagagactctttgtgggactggacattatgcatcctaaatctttatcaaaatatgcaaatctcctcactgagttgccttggatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtatgtgtagccacattaatggcctattttgtagtcactattaaaaggaacatcgattgatattgaatacatgttatggtctttaatccatcttcccattcttatttaattgttattgacaggaaagtctgtttatctgtttttactagtgtatattgtgcttacaatatagaaacgaagatttattttctgaggttacagccagaagtcaattaaattagttttaaatgacatatgcatggttaattttatttagatcattaagttcataatacttaattaaaatgagtacagtcaacatatagcaatgtataagtaagttaagttt

Function

GO:

id name namespace
GO:0001704 formation of primary germ layer biological_process
GO:0001706 endoderm formation biological_process
GO:0042074 cell migration involved in gastrulation biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0007492 endoderm development biological_process
GO:0048762 mesenchymal cell differentiation biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0002030 inhibitory G protein-coupled receptor phosphorylation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0060976 coronary vasculature development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0048598 embryonic morphogenesis biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044238 primary metabolic process biological_process
GO:1904323 regulation of inhibitory G protein-coupled receptor phosphorylation biological_process
GO:1904325 positive regulation of inhibitory G protein-coupled receptor phosphorylation biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0001570 vasculogenesis biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0051281 positive regulation of release of sequestered calcium ion into cytosol biological_process
GO:0060485 mesenchyme development biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0007369 gastrulation biological_process
GO:0071704 organic substance metabolic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0010524 positive regulation of calcium ion transport into cytosol biological_process
GO:0050789 regulation of biological process biological_process
GO:0050794 regulation of cellular process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:1903587 regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:1903589 positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0001667 ameboidal-type cell migration biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0035987 endodermal cell differentiation biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0008078 mesodermal cell migration biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0060182 apelin receptor activity molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00074886 True 854 lncRNA 0.36 3 10562638 10564946

Neighbor

gene id symbol gene type direction distance location
XLOC_036980 BX936345.1 coding upstream 218658 10343864 ~ 10343980 (+)
XLOC_036979 NA coding upstream 405091 10155978 ~ 10157547 (+)
XLOC_036978 nxph2a coding upstream 518779 10014514 ~ 10043859 (+)
XLOC_036977 ttf2 coding upstream 612151 9927516 ~ 9950487 (+)
XLOC_036976 NA coding upstream 665681 9893106 ~ 9896957 (+)
XLOC_036983 cxcr4b coding downstream 127959 10692905 ~ 10694930 (+)
XLOC_036984 dars1 coding downstream 134092 10699038 ~ 10759513 (+)
XLOC_036985 NA coding downstream 172140 10737086 ~ 10760113 (+)
XLOC_036986 gmppaa coding downstream 205934 10770880 ~ 10780660 (+)
XLOC_036987 NA coding downstream 371827 10936773 ~ 10938469 (+)
XLOC_036971 AL954142.1 non-coding upstream 1170407 9371502 ~ 9392231 (+)
XLOC_036991 CR847976.1 non-coding downstream 882831 11447777 ~ 11447909 (+)
XLOC_036995 NA non-coding downstream 1896673 12461619 ~ 12469043 (+)
XLOC_036996 CR752651.1 non-coding downstream 2263059 12828005 ~ 12828120 (+)
XLOC_036972 AL954142.3 non-coding upstream 1184660 9377863 ~ 9377978 (+)

Expression


Co-expression Network