G1762585 (lmo7)



Basic Information


Item Value
gene id G1762585
gene name lmo7
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 765162 ~ 777464 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2019255
GAGCAGTCTAGGAGAACTGGTGAAGGTGCCATCTTCCTCCGTGTACATGGGGCTGGCCCAGCTCCGACGGCTGTCCTCGTGGCGCTCGGCCCGCTTCTTGCGGAGCGGCGCTGGCACATAGGCCGCTGGCTTGTCCTTGGTGGGCAGGAACTGGTTGAACTGCGTGGTCGTTTTAGGCTCGATGACCAGCGAGCGGCGGTAGTGCAGTGAATCCTTGTTACTGTCTGCCGCCATCCTGAAGACTGAGTCCGTCTCCGCGACACTCTCAC

Function


symbol description
lmo7 Predicted to enable actinin binding activity; metal ion binding activity; and protein C-terminus binding activity. Involved in positive regulation of transcription by RNA polymerase II. Located in cell surface; cytoplasm; and nuclear envelope.

NR:

description
LIM domain only protein 7-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2019255 True 269 lncRNA 0.62 2 765162 777464

Neighbor


gene id symbol gene type direction distance location
kctd12.1 kctd12 coding upstream 116872 646700 ~ 648290 (+)
fbxl3a fbxl3 coding upstream 169582 582486 ~ 595580 (+)
mycbp2 NA coding upstream 197734 273113 ~ 567428 (+)
trnat-cgu-77 NA coding upstream 597145 167946 ~ 168017 (+)
trnaa-ugc-172 NA coding upstream 597688 167403 ~ 167474 (+)
commd6 comd6 coding downstream 103669 881133 ~ 887974 (+)
tbc1d4 tbc1d4 coding downstream 124609 902073 ~ 1041922 (+)
klf12b klf12 coding downstream 467976 1245440 ~ 1412460 (+)
dachd dach1 coding downstream 826009 1603473 ~ 1937757 (+)
LOC110501252 LOC106581638 coding downstream 1715625 2492932 ~ 2499544 (+)
G1762578 NA non-coding upstream 9654 753772 ~ 755508 (+)
G1762577 lmo7 non-coding upstream 11946 752921 ~ 753216 (+)
G1762573 NA non-coding upstream 18248 744570 ~ 746914 (+)
G1762526 NA non-coding upstream 97414 648595 ~ 667748 (+)
G1762508 cln5 non-coding upstream 149279 615283 ~ 615883 (+)
G1762650 NA non-coding downstream 86476 863940 ~ 919969 (+)
G1762636 NA non-coding downstream 93862 871326 ~ 871954 (+)
G1762756 NA non-coding downstream 268851 1046315 ~ 1047075 (+)
G1762789 NA non-coding downstream 330332 1107796 ~ 1156721 (+)
G1763386 NA non-coding downstream 391414 1168878 ~ 1169150 (+)
G1762567 NA other upstream 43032 717522 ~ 722130 (+)
G1764378 ebi2 other downstream 1238645 2016109 ~ 2028403 (+)
G1764876 NA other downstream 1663609 2441073 ~ 2442508 (+)
ppp2r3b LOC106581654 other downstream 3780577 4501681 ~ 4562208 (+)
G1769230 NA other downstream 5023051 5800515 ~ 5825298 (+)

Expression


G1762585(lmo7) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1762585(lmo7) Expression in each Bioproject

Bar chart with 6 bars.
G1762585(lmo7) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.5.
End of interactive chart.

Co-expression Network