G1769461



Basic Information


Item Value
gene id G1769461
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 6057279 ~ 6057582 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2026610
tctttcaataatgacaggaatggaggtggtctttatcctagtgagattgctaaggcgaacaccgccatgtttagttttgcccaacctaggtcgaggcacagacatggtctcaatggtgatagctgagctgactacactgactgtgctagtggcagactccactatgctggcaggctggctaacagcctgctgcctggcctgcaccctatttcattgtggagctagaggagttagagccctgtctatgttggtagataaaatgagagcacccctccagctaggatggggtccgtcactcctcagc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2026610 True 304 TUCP 0.51 1 6057279 6057582

Neighbor


gene id symbol gene type direction distance location
LOC118943574 NA coding upstream 150380 5906162 ~ 5906899 (+)
obsl1b LOC106581677 coding upstream 317494 5668212 ~ 5739785 (+)
LOC118943573 NA coding upstream 859883 5191929 ~ 5197396 (+)
LOC110501275 LOC106581666 coding upstream 937567 5023900 ~ 5119712 (+)
LOC110501273 LOC106581650 coding upstream 1281381 4763021 ~ 4775898 (+)
LOC118943575 NA coding downstream 66704 6124286 ~ 6128819 (+)
LOC110502039 LOC106581999 coding downstream 1276127 7333709 ~ 7339054 (+)
LOC118936580 NA coding downstream 1336057 7393639 ~ 7417439 (+)
LOC110501293 LOC106582013 coding downstream 1367705 7425287 ~ 7447727 (+)
LOC110501294 LOC106582012 coding downstream 1395471 7453053 ~ 7472601 (+)
G1769441 NA non-coding upstream 37017 6014800 ~ 6020262 (+)
G1769435 NA non-coding upstream 48660 5995657 ~ 6008619 (+)
G1769422 NA non-coding upstream 104357 5952706 ~ 5952922 (+)
G1769419 NA non-coding upstream 107650 5949417 ~ 5949629 (+)
G1769410 NA non-coding upstream 112451 5944552 ~ 5944828 (+)
G1769467 NA non-coding downstream 2570 6060152 ~ 6060452 (+)
G1769471 NA non-coding downstream 5630 6063212 ~ 6063431 (+)
G1769489 NA non-coding downstream 47171 6104753 ~ 6174707 (+)
G1769748 NA non-coding downstream 171142 6228724 ~ 6228949 (+)
G1769833 NA non-coding downstream 232502 6290084 ~ 6290310 (+)
G1769403 NA other upstream 120487 5936370 ~ 5936792 (+)
G1769230 NA other upstream 231981 5800515 ~ 5825298 (+)
ppp2r3b LOC106581654 other upstream 1495132 4501681 ~ 4562208 (+)
G1764876 NA other upstream 3614771 2441073 ~ 2442508 (+)
G1764378 ebi2 other upstream 4028876 2016109 ~ 2028403 (+)
G1769469 NA other downstream 3713 6061295 ~ 6061739 (+)
G1770757 NA other downstream 1176992 7234574 ~ 7282742 (+)
G1771131 LOC106581993 other downstream 1266053 7323635 ~ 7326020 (+)
G1771580 NA other downstream 1709483 7767065 ~ 7767508 (+)

Expression


G1769461 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1769461 Expression in each Bioproject

Bar chart with 19 bars.
G1769461 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network