G1771658



Basic Information


Item Value
gene id G1771658
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 7921813 ~ 7947715 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2028993
taataaacaaaagtgaaataaacaataaacaattaacagtaacattacagaataaagacatttcaagtgtcatattatgtctatgtacagtgttgtatacattctgatgtgcaaatagttaaagtgcaaagggaaaaaaaataaacataaatacgggttgtatttacaatggtgtttgttcttcactggttgcccttttcttgtggcaacaggtcgcaaagttcaagggggccgaatactttcgcaaggcactgta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2028993 True 256 lncRNA 0.34 2 7921813 7947715

Neighbor


gene id symbol gene type direction distance location
LOC118943576 NA coding upstream 405446 7515353 ~ 7516367 (+)
LOC110501295 LOC106582015 coding upstream 433513 7480701 ~ 7488300 (+)
LOC110501294 LOC106582012 coding upstream 449212 7453053 ~ 7472601 (+)
LOC110501293 LOC106582013 coding upstream 474086 7425287 ~ 7447727 (+)
LOC118936580 NA coding upstream 504374 7393639 ~ 7417439 (+)
rev1 rev1 coding downstream 8655 7956370 ~ 7978486 (+)
LOC110501308 txndc9 coding downstream 41100 7988815 ~ 7992218 (+)
mitd1 mitd1 coding downstream 45659 7993374 ~ 8006327 (+)
cracdla LOC106582029 coding downstream 69197 8016912 ~ 8025026 (+)
creg2 creg2 coding downstream 77648 8025363 ~ 8027524 (+)
G1771660 NA non-coding upstream 30069 7891346 ~ 7891744 (+)
G1771651 LOC106582025 non-coding upstream 38759 7873683 ~ 7883054 (+)
G1771648 NA non-coding upstream 53261 7866073 ~ 7868552 (+)
G1771592 NA non-coding upstream 58555 7859886 ~ 7863258 (+)
G1771589 NA non-coding upstream 134494 7787099 ~ 7787319 (+)
G1771750 NA non-coding downstream 145484 8093199 ~ 8093423 (+)
G1771754 NA non-coding downstream 151608 8099323 ~ 8099767 (+)
G1771755 NA non-coding downstream 152086 8099801 ~ 8100018 (+)
G1772083 NA non-coding downstream 292854 8240569 ~ 8316560 (+)
LOC110501320 LOC106581986 non-coding downstream 318117 8265832 ~ 8283461 (+)
G1771580 NA other upstream 154305 7767065 ~ 7767508 (+)
G1771131 LOC106581993 other upstream 595793 7323635 ~ 7326020 (+)
G1770757 NA other upstream 639071 7234574 ~ 7282742 (+)
G1769469 NA other upstream 1860074 6061295 ~ 6061739 (+)
LOC110501322 LOC106581983 other downstream 410579 8358225 ~ 8410070 (+)
G1772554 gpr161 other downstream 1107990 9055705 ~ 9056402 (+)
G1772556 LOC106567841 other downstream 1158300 9106015 ~ 9122457 (+)
LOC110501352 gpr34 other downstream 1436645 9384301 ~ 9387652 (+)
G1775959 NA other downstream 3564250 11511965 ~ 11516413 (+)

Expression


G1771658 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1771658 Expression in each Bioproject

Bar chart with 11 bars.
G1771658 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network