G1772554 (gpr161)



Basic Information


Item Value
gene id G1772554
gene name gpr161
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 9055705 ~ 9056402 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2029990
TGCTGAAGAGGCGTGACGTGCGGTGGCGTGTGGCGAACGACTCCACGCGGTAGTAGCGATCCCCGAAGCACATGCCCAGCAGTTCCTTTCGCACAGTCTTGTTCCACAGGCCGTAGATGAGCGGGTGGCAGACGGCGCTGCAGAAGGACAGCCAAGCCACCAGGGTCTCCAGGCCCTGGGACACGCTGCCCTGACCCCACAGGGCCTCTGTACACACCACCCCCACGTAGGGGCCCCAGGTCACCAGGAAGGTCCCGATCACCACCATAATGGTGACGAAAGCCTTGCACTGGCTCCCAGCATACACTAAACTCCACCGGCTTCCATTGGACGACGTGGACGTAGATGAGTTTTTACGCTGGTCGTTCCTCTGAGCACCCGATGACGTTTCTTCTGAAGACGCGACCACCGTCGTCCCACAATGCACCTTGCGGGCCTTGAGGCGTGCCACGCGGAAGATTACGCCGTAGCAGGCCAACATGGCGAGCAGTGGCGGCAGGCTGCACCAGGTGACCCAGAAGGCGGTGTAGGCAGGGGTGCGGTGCCAGGCCGCCACGCATGTCCACTTGAAGCGGTCGAACTCGAAGGAGGACCAGCCGAAGAGGGGTGGCAGGCAGCCCACCAGGGAGTGCACCCACACATAGACGATTGCCACCACCGCCCGGTTGCCTGTGATCTTCATGGGGTAGATCATGGGG

Function


symbol description
gpr161 Predicted to enable G protein-coupled receptor activity. Predicted to be involved in adenylate cyclase-activating G protein-coupled receptor signaling pathway and negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning. Predicted to be located in cilium. Predicted to be active in recycling endosome.

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2029990 True 698 TUCP 0.62 1 9055705 9056402
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110501341 dcaf6 coding upstream 13228 8968202 ~ 9042477 (+)
LOC110501340 LOC106581959 coding upstream 98074 8953576 ~ 8957631 (+)
LOC118943731 NA coding upstream 100954 8954570 ~ 8954751 (+)
me3 LOC106581960 coding upstream 126205 8912652 ~ 8929500 (+)
LOC110501337 LOC106581962 coding upstream 150760 8873995 ~ 8904945 (+)
LOC110501343 LOC106581954 coding downstream 38292 9094694 ~ 9103542 (+)
LOC118943577 LOC106581954 coding downstream 49102 9105504 ~ 9114188 (+)
LOC110502045 LOC106581954 coding downstream 60095 9116497 ~ 9122873 (+)
prmt2 prmt2 coding downstream 70967 9127369 ~ 9137539 (+)
usp9 LOC106581949 coding downstream 154108 9210510 ~ 9288763 (+)
G1772552 NA non-coding upstream 823 9054608 ~ 9054882 (+)
G1772548 NA non-coding upstream 11101 9044367 ~ 9044604 (+)
G1772506 NA non-coding upstream 88919 8966586 ~ 8966786 (+)
G1772497 NA non-coding upstream 95655 8959835 ~ 8960050 (+)
G1772495 NA non-coding upstream 97098 8958234 ~ 8958607 (+)
G1772571 NA non-coding downstream 8282 9064684 ~ 9065090 (+)
G1772570 NA non-coding downstream 10252 9066654 ~ 9066947 (+)
G1772572 NA non-coding downstream 12158 9068560 ~ 9068898 (+)
G1772575 NA non-coding downstream 16933 9073335 ~ 9073623 (+)
G1772580 NA non-coding downstream 24424 9080826 ~ 9081028 (+)
LOC110501322 LOC106581983 other upstream 648000 8358225 ~ 8410070 (+)
G1771580 NA other upstream 1288197 7767065 ~ 7767508 (+)
LOC110501294 LOC106582012 other upstream 1583214 7453053 ~ 7472601 (+)
G1771131 LOC106581993 other upstream 1729685 7323635 ~ 7326020 (+)
G1770757 NA other upstream 1772963 7234574 ~ 7282742 (+)
G1772556 LOC106567841 other downstream 49613 9106015 ~ 9122457 (+)
LOC110501352 gpr34 other downstream 327958 9384301 ~ 9387652 (+)
G1775959 NA other downstream 2455563 11511965 ~ 11516413 (+)
G1775962 LOC100286503 other downstream 2464321 11520723 ~ 11522390 (+)
LOC110501387 LOC106581925 other downstream 2796069 11852404 ~ 11863661 (+)

Expression


G1772554(gpr161) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G1772554(gpr161) Expression in each Bioproject

Bar chart with 2 bars.
G1772554(gpr161) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.
End of interactive chart.

Co-expression Network