G1779798



Basic Information


Item Value
gene id G1779798
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 14079504 ~ 14079950 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2037863
gaggaggaaggctctggcagtgctagataggcgggagactccggcagcgctggagaagaggaaggccctggcagcgctggacaggcgaggcgcactgtaggcctgatgcgtggtgctggcactggtggtactgggccgagaacacgcacaggaagcctggtgcggggagctgccaccggagggctggtgtgtggaggtggtactggatagacaggactgtgcaggcgcactggagctcttgagcaccgagcctgcccaaccttacctggctcgatgcccactctagcccggccgatacgaggagctggtatgtaccgcaccgggctatgcacccgcactggagacaccgtgcgcaccacagcataacacggtgcctgcccggtctctctatccccccggtaagcacaggaagttggcgtaggtctcctacctggcgtagccatactc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2037863 True 447 lncRNA 0.64 1 14079504 14079950
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502113 NA coding downstream 236175 13838464 ~ 13843329 (-)
LOC110501426 LOC106581739 coding downstream 1103659 12963389 ~ 12975845 (-)
LOC110501425 LOC106581740 coding downstream 1127407 12942551 ~ 12952097 (-)
LOC110502048 NA coding downstream 1144157 12928202 ~ 12935504 (-)
LOC110501424 i20ra coding downstream 1160331 12912761 ~ 12919173 (-)
nepro nepro coding upstream 40857 14120807 ~ 14127458 (-)
tex30 LOC106581745 coding upstream 47641 14127591 ~ 14131604 (-)
poglut2 kdelc1 coding upstream 52209 14132159 ~ 14156711 (-)
stxbp5l stxbp5l coding upstream 77244 14157194 ~ 14392227 (-)
gtf2e1 gtf2e1 coding upstream 363578 14443528 ~ 14489125 (-)
G1779688 NA non-coding downstream 140924 13938147 ~ 13938580 (-)
G1779000 NA non-coding downstream 194152 13885113 ~ 13885352 (-)
G1778649 NA non-coding downstream 448006 13631280 ~ 13631498 (-)
G1778604 NA non-coding downstream 483318 13595976 ~ 13596186 (-)
G1778482 NA non-coding downstream 573861 13505364 ~ 13505643 (-)
G1779799 NA non-coding upstream 2685 14082635 ~ 14082902 (-)
G1779807 NA non-coding upstream 27290 14107240 ~ 14108618 (-)
G1779818 NA non-coding upstream 38489 14118439 ~ 14118710 (-)
G1779863 NA non-coding upstream 118828 14198778 ~ 14303481 (-)
G1779894 NA non-coding upstream 170754 14250704 ~ 14251221 (-)
G1778224 NA other downstream 749009 13279280 ~ 13330495 (-)
G1778140 efnb2 other downstream 906525 13168780 ~ 13172979 (-)
LOC110501411 LOC106581904 other downstream 1454810 12620582 ~ 12624860 (-)
G1777441 LOC106581914 other downstream 1809390 12268217 ~ 12270114 (-)
G1777286 NA other downstream 2037882 12041108 ~ 12041622 (-)
G1781137 lrp2 other upstream 1487553 15567503 ~ 15568534 (-)
b3galt1b LOC106581793 other upstream 1605906 15684423 ~ 15825221 (-)
LOC110501514 dapl1 other upstream 2977172 17057104 ~ 17063550 (-)
G1783895 LOC106581829 other upstream 3789579 17869529 ~ 17903951 (-)
LOC110501547 LOC106586143 other upstream 5095617 19175567 ~ 19179266 (-)

Expression


G1779798 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1779798 Expression in each Bioproject

Bar chart with 20 bars.
G1779798 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network