G1780369



Basic Information


Item Value
gene id G1780369
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 15090764 ~ 15091937 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2038519
cttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccccttaagttaatactttgtagcgccaccttttgctgcgattacagttgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttattttagaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcctcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggttttatctgaacagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacgacactttttatggatatctttaagaaatagctttcttcttgccactcttctataaaggccagatttgtgcaatatacaactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaacgtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgtctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacagagacttgattacacacaggtggattgtatttatcatcattag

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2038519 True 1174 lncRNA 0.43 1 15090764 15091937

Neighbor


gene id symbol gene type direction distance location
LOC110501456 LOC106581769 coding upstream 24962 15045334 ~ 15065802 (+)
LOC110501453 LOC106581766 coding upstream 120763 14967670 ~ 14970001 (+)
ppp1r9ala LOC106581761 coding upstream 205576 14851810 ~ 14885188 (+)
LOC110502114 NA coding upstream 373149 14711709 ~ 14717615 (+)
LOC110501446 LOC106581756 coding upstream 402653 14681021 ~ 14688111 (+)
mettl8 mettl8 coding downstream 12441 15104378 ~ 15117153 (+)
LOC110501461 tlk1 coding downstream 30705 15122642 ~ 15148331 (+)
mettl5 mettl5 coding downstream 262595 15354532 ~ 15358880 (+)
fastkd1 fakd1 coding downstream 309855 15401792 ~ 15415120 (+)
lrp2a lrp2 coding downstream 411123 15503060 ~ 15572970 (+)
G1780367 NA non-coding upstream 1145 15089401 ~ 15089619 (+)
G1780332 NA non-coding upstream 77746 15007633 ~ 15013018 (+)
G1780304 NA non-coding upstream 98373 14991976 ~ 14992391 (+)
G1780303 NA non-coding upstream 98967 14991545 ~ 14991797 (+)
G1780294 NA non-coding upstream 109847 14980700 ~ 14980917 (+)
G1780377 NA non-coding downstream 10485 15102422 ~ 15102721 (+)
G1780378 NA non-coding downstream 11417 15103354 ~ 15103579 (+)
G1780399 NA non-coding downstream 78604 15170541 ~ 15171671 (+)
G1780401 NA non-coding downstream 80295 15172232 ~ 15180278 (+)
G1780353 NA other upstream 47121 15038099 ~ 15043643 (+)
G1779636 NA other upstream 187504 14902795 ~ 14903260 (+)
G1779170 NA other upstream 1011025 14079497 ~ 14079739 (+)
LOC110501417 LOC106581898 other upstream 2303186 12756352 ~ 12787590 (+)
G1776709 NA other upstream 2332568 12690062 ~ 12761001 (+)
G1780491 NA other downstream 199425 15291362 ~ 15347666 (+)
G1780575 NA other downstream 332774 15424711 ~ 15433820 (+)
G1781293 LOC106586198 other downstream 747667 15839604 ~ 15848595 (+)
G1781423 LOC106581799 other downstream 970820 16062757 ~ 16063401 (+)
G1781813 NA other downstream 1180452 16272389 ~ 16273110 (+)

Expression


G1780369 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1780369 Expression in each Bioproject

Bar chart with 21 bars.
G1780369 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network