XLOC_003710 (CABZ01080006.1)


Basic Information

Item Value
gene id XLOC_003710
gene name CABZ01080006.1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 43070883 ~ 43077341 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00007183
ATGGAGCAGAAAACCCAGTGTTATGCAGAAATACATCTGCCTCGGAGAAGGAAGGTTTGGGAGGTTTTCCATTCAAACAGCTTCAGGATATTTGATGAAACTCTGCCGGAGCGTCTGGATCCTGCGAGTGTCTGTCCGAGACAGAAATGTCCTTCTGGATCTGTGAAGGAGTCCGAGAGCCGAAACGTCCCGCATCCACACAACGCCAGCTTCATCAGGACCAACGTCAGAAACACACATTCCTGA

Function

GO:

id name namespace
GO:0048731 system development biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0048468 cell development biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0007219 Notch signaling pathway biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0030154 cell differentiation biological_process
GO:0048513 animal organ development biological_process
GO:1990399 epithelium regeneration biological_process
GO:0000904 cell morphogenesis involved in differentiation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0030182 neuron differentiation biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0007275 multicellular organism development biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0060429 epithelium development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051239 regulation of multicellular organismal process biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0048869 cellular developmental process biological_process
GO:0045595 regulation of cell differentiation biological_process
GO:2000026 regulation of multicellular organismal development biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0050767 regulation of neurogenesis biological_process
GO:0070654 sensory epithelium regeneration biological_process
GO:0048646 anatomical structure formation involved in morphogenesis biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0061564 axon development biological_process
GO:0003002 regionalization biological_process
GO:0007389 pattern specification process biological_process
GO:0050789 regulation of biological process biological_process
GO:0048666 neuron development biological_process
GO:0050793 regulation of developmental process biological_process
GO:0050794 regulation of cellular process biological_process
GO:0007399 nervous system development biological_process
GO:0048934 peripheral nervous system neuron differentiation biological_process
GO:0048935 peripheral nervous system neuron development biological_process
GO:0032501 multicellular organismal process biological_process
GO:0048936 peripheral nervous system neuron axonogenesis biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0007409 axonogenesis biological_process
GO:0060284 regulation of cell development biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:0007422 peripheral nervous system development biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0022008 neurogenesis biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0048699 generation of neurons biological_process
GO:0031175 neuron projection development biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0021510 spinal cord development biological_process
GO:0060322 head development biological_process
GO:0021514 ventral spinal cord interneuron differentiation biological_process
GO:0021515 cell differentiation in spinal cord biological_process
GO:0009790 embryo development biological_process
GO:0021517 ventral spinal cord development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0051960 regulation of nervous system development biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0005112 Notch binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0046983 protein dimerization activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function
GO:0001161 intronic transcription regulatory region sequence-specific DNA binding molecular_function
GO:0001162 RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000117768

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00007183 True 246 lncRNA 0.50 3 43070883 43077341

Neighbor

gene id symbol gene type direction distance location
XLOC_003708 NA coding upstream 22862 43035558 ~ 43048021 (+)
XLOC_003709 CABZ01092982.1 coding upstream 25934 43044826 ~ 43044949 (+)
XLOC_003707 NA coding upstream 187585 42839850 ~ 42883298 (+)
XLOC_003705 tdrd3 coding upstream 251153 42726712 ~ 42819730 (+)
XLOC_003706 zgc:194981 coding upstream 338443 42730639 ~ 42732440 (+)
XLOC_003711 foxg1b coding downstream 36767 43114108 ~ 43116249 (+)
XLOC_003712 CABZ01058277.1 coding downstream 217934 43295275 ~ 43297633 (+)
XLOC_003713 CU929458.1 coding downstream 285734 43363075 ~ 43368382 (+)
XLOC_003714 sult6b1 coding downstream 297985 43375326 ~ 43388063 (+)
XLOC_003715 vipb coding downstream 323860 43401201 ~ 43414172 (+)
XLOC_003369 CR854846.2 misc upstream 26947801 16122786 ~ 16123082 (+)
XLOC_003318 CR450764.6 misc upstream 30358887 12711700 ~ 12711996 (+)
XLOC_003317 CR450764.16 misc upstream 30376620 12693967 ~ 12694263 (+)
XLOC_003316 CR450764.11 misc upstream 30385284 12685304 ~ 12685599 (+)
XLOC_003315 CR450764.18 misc upstream 30390855 12679732 ~ 12680028 (+)
XLOC_003703 LO017916.1 non-coding upstream 445396 42625371 ~ 42625487 (+)
XLOC_003700 FP067440.1 non-coding upstream 497901 42572242 ~ 42572982 (+)
XLOC_003717 NA non-coding downstream 455241 43532582 ~ 43535890 (+)
XLOC_003718 CABZ01073015.1 non-coding downstream 565817 43643158 ~ 43646674 (+)
XLOC_003722 NA non-coding downstream 734288 43811629 ~ 43817356 (+)
XLOC_003723 NA non-coding downstream 744214 43821555 ~ 43822853 (+)

Expression


Co-expression Network