G1786737



Basic Information


Item Value
gene id G1786737
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 20193042 ~ 20193459 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2045371
gtatattggtttctaacttccctgaaaagttgcatatcacgggggctgttcgatgctaatgcagaacgccataggatgtttttgtgttggttattaagggcagtcaggtctggagagaaccaagggctatatctgttcctggttctaaatttcttgaatggggcatgcttatttaagatggtgaggaaggcatttaaaaaaaaaacaggcatcctctactgacgggatgaggtcaatatccttccaggatacccgggccaggtcgattagaaaggcctgctcgctgaagtgtttcagggagcgtttgacagtgatgagtggaggtcgttgaccgctgacccattacggatgcaggcaatgaggcagtgatcgctgagatcttggttgaaaacagcagaggtgtatttagagggcaagt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2045371 True 418 lncRNA 0.47 1 20193042 20193459
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118943631 NA coding downstream 403119 19788794 ~ 19789923 (-)
LOC110501577 LOC106581859 coding downstream 405517 19769408 ~ 19787525 (-)
vil1 vil1 coding downstream 429182 19743720 ~ 19763860 (-)
znf142 znf142 coding downstream 526841 19655763 ~ 19666201 (-)
LOC110501567 usp37 coding downstream 589484 19572445 ~ 19603558 (-)
agr1 LOC106581734 coding upstream 2253 20195712 ~ 20203864 (-)
hdac4 hdac4 coding upstream 186006 20379465 ~ 20660978 (-)
LOC118943627 NA coding upstream 497057 20690516 ~ 20692314 (-)
LOC110501586 LOC106581869 coding upstream 537451 20730910 ~ 20739954 (-)
LOC100136257 LOC100136257 coding upstream 572453 20765912 ~ 20777157 (-)
G1786733 NA non-coding downstream 2255 20190522 ~ 20190787 (-)
G1786709 NA non-coding downstream 9719 20155463 ~ 20183323 (-)
G1786720 NA non-coding downstream 17398 20171839 ~ 20175644 (-)
G1786654 LOC107662719 non-coding downstream 101930 20090681 ~ 20091112 (-)
G1786646 NA non-coding downstream 110380 20082386 ~ 20082662 (-)
G1786751 NA non-coding upstream 26747 20220206 ~ 20221073 (-)
G1786777 NA non-coding upstream 71188 20264647 ~ 20265233 (-)
G1786781 NA non-coding upstream 74103 20267562 ~ 20267764 (-)
G1786788 NA non-coding upstream 87700 20281159 ~ 20281832 (-)
G1786789 NA non-coding upstream 89654 20283113 ~ 20283322 (-)
G1785753 NA other downstream 871183 19321188 ~ 19321859 (-)
LOC110501547 LOC106586143 other downstream 1013858 19175567 ~ 19179266 (-)
G1783895 LOC106581829 other downstream 2289091 17869529 ~ 17903951 (-)
LOC110501514 dapl1 other downstream 3129594 17057104 ~ 17063550 (-)
G1786832 LOC100136012 other upstream 152240 20345699 ~ 20346014 (-)
G1787166 NA other upstream 197057 20390516 ~ 20455983 (-)
LOC110501594 LOC106581696 other upstream 1597297 21788428 ~ 21913721 (-)
G1789581 NA other upstream 2224671 22418130 ~ 22419498 (-)
G1790280 NA other upstream 2971022 23164481 ~ 23169363 (-)

Expression


G1786737 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1786737 Expression in each Bioproject

Bar chart with 20 bars.
G1786737 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network