G1788988



Basic Information


Item Value
gene id G1788988
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 21978386 ~ 21978618 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2047780
CATCAGAATTTGCCATTGTCTTGCTGAAAATGTTACATCTGGTTTCATCTTGCCGTAATAAGTCGACTATGTGAACGCAGCAAACTGCTGTACTACTGCACCACTAATACAGGCTTGAGATCAGCTCTAAATCTATTCTATTACACCCACTACACCACTGACACACTGGAATACTGACCTGTGATCATCACTAAGACTAGCTGGTTTAATAAGACCTATATCAATCATAATGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2047780 True 233 lncRNA 0.40 1 21978386 21978618
Loading

Neighbor


gene id symbol gene type direction distance location
stk17b LOC106581692 coding downstream 20682 21936514 ~ 21957704 (-)
ftcdnl1 LOC106581695 coding downstream 41972 21922800 ~ 21936414 (-)
LOC110501594 LOC106581696 coding downstream 64665 21788428 ~ 21913721 (-)
LOC110501591 LOC106581664 coding downstream 212155 21708881 ~ 21766231 (-)
LOC110501588 LOC106581699 coding downstream 387387 21572564 ~ 21590999 (-)
LOC110502069 LOC106582011 coding upstream 260560 22239178 ~ 22636506 (-)
LOC110501602 LOC106582008 coding upstream 1012076 22990694 ~ 22996267 (-)
LOC118943636 LOC106582008 coding upstream 1045352 23023970 ~ 23042872 (-)
dcbld2 LOC106582006 coding upstream 1078026 23056644 ~ 23079508 (-)
LOC110502006 LOC106582004 coding upstream 1219148 23197766 ~ 23235688 (-)
hecw2a LOC106581691 non-coding downstream 8856 21969152 ~ 22021354 (-)
G1788981 NA non-coding downstream 11299 21966782 ~ 21967087 (-)
G1788980 NA non-coding downstream 13328 21964622 ~ 21965058 (-)
G1788964 NA non-coding downstream 36839 21940742 ~ 21941547 (-)
G1788856 NA non-coding downstream 80258 21897596 ~ 21898128 (-)
G1788990 NA non-coding upstream 3043 21981661 ~ 21981879 (-)
G1788992 NA non-coding upstream 4237 21982855 ~ 21983230 (-)
G1788993 NA non-coding upstream 7860 21986478 ~ 21986709 (-)
G1788994 NA non-coding upstream 8409 21987027 ~ 21987240 (-)
G1788996 NA non-coding upstream 10360 21988978 ~ 21989245 (-)
G1787166 NA other downstream 1522403 20390516 ~ 20455983 (-)
G1786832 LOC100136012 other downstream 1632372 20345699 ~ 20346014 (-)
znf142 znf142 other downstream 2319286 19655763 ~ 19666201 (-)
G1785753 NA other downstream 2656527 19321188 ~ 19321859 (-)
G1789581 NA other upstream 439512 22418130 ~ 22419498 (-)
G1790280 NA other upstream 1185863 23164481 ~ 23169363 (-)
LOC110501997 LOC106582152 other upstream 1454376 23368423 ~ 23460589 (-)
G1791405 NA other upstream 2348111 24326729 ~ 24327127 (-)
G1792342 LOC106582127 other upstream 2869973 24848591 ~ 24849752 (-)

Expression


G1788988 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1788988 Expression in each Bioproject

Bar chart with 5 bars.
G1788988 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network