G1788993



Basic Information


Item Value
gene id G1788993
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 21986478 ~ 21986709 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2047785
tgaatatacagtgcattcggaaagtattcagaccccttgactttttcaaatcaaatcaaatcaaatcaaattttatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtaaggggataaagaatatgtacataag

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2047785 True 232 lncRNA 0.34 1 21986478 21986709

Neighbor


gene id symbol gene type direction distance location
stk17b LOC106581692 coding downstream 28774 21936514 ~ 21957704 (-)
ftcdnl1 LOC106581695 coding downstream 50064 21922800 ~ 21936414 (-)
LOC110501594 LOC106581696 coding downstream 72757 21788428 ~ 21913721 (-)
LOC110501591 LOC106581664 coding downstream 220247 21708881 ~ 21766231 (-)
LOC110501588 LOC106581699 coding downstream 395479 21572564 ~ 21590999 (-)
LOC110502069 LOC106582011 coding upstream 252469 22239178 ~ 22636506 (-)
LOC110501602 LOC106582008 coding upstream 1003985 22990694 ~ 22996267 (-)
LOC118943636 LOC106582008 coding upstream 1037261 23023970 ~ 23042872 (-)
dcbld2 LOC106582006 coding upstream 1069935 23056644 ~ 23079508 (-)
LOC110502006 LOC106582004 coding upstream 1211057 23197766 ~ 23235688 (-)
G1788992 NA non-coding downstream 3248 21982855 ~ 21983230 (-)
G1788990 NA non-coding downstream 4599 21981661 ~ 21981879 (-)
G1788988 NA non-coding downstream 7860 21978386 ~ 21978618 (-)
hecw2a LOC106581691 non-coding downstream 16948 21969152 ~ 22021354 (-)
G1788981 NA non-coding downstream 19391 21966782 ~ 21967087 (-)
G1788994 NA non-coding upstream 318 21987027 ~ 21987240 (-)
G1788996 NA non-coding upstream 2269 21988978 ~ 21989245 (-)
G1788999 NA non-coding upstream 7440 21994149 ~ 21994387 (-)
G1789000 LOC100194703 non-coding upstream 10040 21996749 ~ 21997036 (-)
G1789001 NA non-coding upstream 11891 21998600 ~ 21998967 (-)
G1787166 NA other downstream 1530495 20390516 ~ 20455983 (-)
G1786832 LOC100136012 other downstream 1640464 20345699 ~ 20346014 (-)
znf142 znf142 other downstream 2327378 19655763 ~ 19666201 (-)
G1785753 NA other downstream 2664619 19321188 ~ 19321859 (-)
G1789581 NA other upstream 431421 22418130 ~ 22419498 (-)
G1790280 NA other upstream 1177772 23164481 ~ 23169363 (-)
LOC110501997 LOC106582152 other upstream 1446285 23368423 ~ 23460589 (-)
G1791405 NA other upstream 2340020 24326729 ~ 24327127 (-)
G1792342 LOC106582127 other upstream 2861882 24848591 ~ 24849752 (-)

Expression



Co-expression Network