G1789047



Basic Information


Item Value
gene id G1789047
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 22083635 ~ 22091952 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2047839
aattttatgggaaaaatgactgatttacagttcatgggggttgcctaatcacacatatgaagttttggacagatctgacttttttaacccttcgaaacagcccctgagacaccaattatggcacttccggttggtacaggaagctataagtcaacacatatcctcattggggtatgcttttacagaatcctgagttttaagtctttacgttcagaactgactgatttacacagggttgaatgcactatgtctatcaaactgcaaggcagggtatggatatacacttttagggtgattttaaccacttctggttggtccaggaagcttagaatcaacacaggtagacctcatagtggcctgattggactgtcaccgaagacaggttcatacggcattcataacccacataggcttcaggttgaatttaggggtgcaggcaatgtattcctatggggagagatgtcattgtaatctgtgagatcaaaaaaccctgttttagtgtgaagggttaatgccacatggtcacggttaggcttgttgagatcgggaggaccttaggaacattcatgtggtggaatttttcttctcaccctaacggttctctcactgtcactcaaaagcaaatgacattgtggggcaggcttcattttgggcctactattctaatggtcggttattgtgttatttcagaaaatcatagaaaatcacagaaatgtcgcagagctccgcagcacactttaaaaagattcgtatgaacaccctgcaactggatctgtaaccgttgaaaaaaaaaacgcctatttgtgaccatcaccaatttgtcattgttccgtttctcttaaatgacgataga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2047839 True 853 lncRNA 0.42 2 22083635 22091952
Loading

Neighbor


gene id symbol gene type direction distance location
hecw2a LOC106581691 coding downstream 62281 21969152 ~ 22021354 (-)
stk17b LOC106581692 coding downstream 125931 21936514 ~ 21957704 (-)
ftcdnl1 LOC106581695 coding downstream 147221 21922800 ~ 21936414 (-)
LOC110501594 LOC106581696 coding downstream 169914 21788428 ~ 21913721 (-)
LOC110501591 LOC106581664 coding downstream 317404 21708881 ~ 21766231 (-)
LOC110502069 LOC106582011 coding upstream 147226 22239178 ~ 22636506 (-)
LOC110501602 LOC106582008 coding upstream 898742 22990694 ~ 22996267 (-)
LOC118943636 LOC106582008 coding upstream 932018 23023970 ~ 23042872 (-)
dcbld2 LOC106582006 coding upstream 964692 23056644 ~ 23079508 (-)
LOC110502006 LOC106582004 coding upstream 1105814 23197766 ~ 23235688 (-)
G1789008 NA non-coding downstream 77007 22006398 ~ 22006628 (-)
G1789007 NA non-coding downstream 77491 22005941 ~ 22006144 (-)
G1789004 NA non-coding downstream 83448 21999987 ~ 22000187 (-)
G1789001 NA non-coding downstream 84668 21998600 ~ 21998967 (-)
G1789000 LOC100194703 non-coding downstream 86599 21996749 ~ 21997036 (-)
G1789062 NA non-coding upstream 44845 22136797 ~ 22137042 (-)
G1789066 NA non-coding upstream 46616 22138568 ~ 22144965 (-)
G1789072 NA non-coding upstream 66869 22158821 ~ 22164963 (-)
G1789075 NA non-coding upstream 74498 22166450 ~ 22167554 (-)
G1789085 NA non-coding upstream 83577 22175529 ~ 22175904 (-)
G1787166 NA other downstream 1627652 20390516 ~ 20455983 (-)
G1786832 LOC100136012 other downstream 1737621 20345699 ~ 20346014 (-)
znf142 znf142 other downstream 2424535 19655763 ~ 19666201 (-)
G1785753 NA other downstream 2761776 19321188 ~ 19321859 (-)
G1789581 NA other upstream 326178 22418130 ~ 22419498 (-)
G1790280 NA other upstream 1072529 23164481 ~ 23169363 (-)
LOC110501997 LOC106582152 other upstream 1341042 23368423 ~ 23460589 (-)
G1791405 NA other upstream 2234777 24326729 ~ 24327127 (-)
G1792342 LOC106582127 other upstream 2756639 24848591 ~ 24849752 (-)

Expression


G1789047 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1789047 Expression in each Bioproject

Bar chart with 18 bars.
G1789047 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network