G1790318 (LOC106581475)



Basic Information


Item Value
gene id G1790318
gene name LOC106581475
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 23249991 ~ 23250229 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2049199
gggtcactcatggtgtggggtggcatttctttgggggggacgcacagccctccatgtgctcgccagaggtagcctgactgccattaggtaccgagatgagatcctcagaccccttgtgagaccatatactggtgcggttggccctgggttcctcctaatgcaagacaatgctagacctcatgtggctggagtgtgtcagcagttcctgcaagaggaaggcattgatgctatggactggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2049199 True 239 lncRNA 0.56 1 23249991 23250229
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502006 LOC106582004 coding downstream 14303 23197766 ~ 23235688 (-)
dcbld2 LOC106582006 coding downstream 170483 23056644 ~ 23079508 (-)
LOC118943636 LOC106582008 coding downstream 207119 23023970 ~ 23042872 (-)
LOC110501602 LOC106582008 coding downstream 253724 22990694 ~ 22996267 (-)
LOC110502069 LOC106582011 coding downstream 613485 22239178 ~ 22636506 (-)
LOC110502001 LOC106582154 coding upstream 48085 23298314 ~ 23327132 (-)
LOC110502000 LOC106582153 coding upstream 83367 23333596 ~ 23351721 (-)
LOC110502015 renr coding upstream 104699 23354928 ~ 23363406 (-)
LOC110501997 LOC106582152 coding upstream 118194 23368423 ~ 23460589 (-)
si:dkey-100n23.5 LOC106582150 coding upstream 226709 23476938 ~ 23578992 (-)
G1790316 NA non-coding downstream 734 23248992 ~ 23249257 (-)
G1790305 NA non-coding downstream 12471 23237235 ~ 23237520 (-)
G1790289 NA non-coding downstream 55823 23193820 ~ 23194168 (-)
G1790287 NA non-coding downstream 57614 23190737 ~ 23192377 (-)
G1790215 NA non-coding downstream 231150 23018621 ~ 23018841 (-)
G1790319 NA non-coding upstream 559 23250788 ~ 23251076 (-)
G1790320 NA non-coding upstream 1264 23251493 ~ 23251716 (-)
G1790926 NA non-coding upstream 58624 23308853 ~ 23309294 (-)
G1790931 NA non-coding upstream 65656 23315885 ~ 23316235 (-)
G1790939 NA non-coding upstream 71123 23321352 ~ 23385292 (-)
G1790280 NA other downstream 80628 23164481 ~ 23169363 (-)
G1789581 NA other downstream 830493 22418130 ~ 22419498 (-)
LOC110501594 LOC106581696 other downstream 1429046 21788428 ~ 21913721 (-)
G1787166 NA other downstream 2794008 20390516 ~ 20455983 (-)
G1786832 LOC100136012 other downstream 2903977 20345699 ~ 20346014 (-)
G1791405 NA other upstream 1076500 24326729 ~ 24327127 (-)
G1792342 LOC106582127 other upstream 1598362 24848591 ~ 24849752 (-)
G1792345 NA other upstream 1606595 24856824 ~ 24857885 (-)
G1792433 NA other upstream 1735730 24985959 ~ 24986268 (-)

Expression


G1790318(LOC106581475) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1790318(LOC106581475) Expression in each Bioproject

Bar chart with 19 bars.
G1790318(LOC106581475) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network