G1792429



Basic Information


Item Value
gene id G1792429
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 24976701 ~ 24977207 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2051512
gcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaagcatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacatggcgttttgcattgttgccaaaaagttcaattttggtttcatctgaccaaagcaccttcttccacatgtttggcgtgtctctcaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttcca

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2051512 True 507 lncRNA 0.42 1 24976701 24977207
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110501608 LOC106582128 coding downstream 191699 24779405 ~ 24785002 (-)
tnfsf13b tnfsf13b coding downstream 197766 24774718 ~ 24778935 (-)
LOC110502073 myo16 coding downstream 220851 24519574 ~ 24755850 (-)
LOC110501998 LOC106582131 coding downstream 712414 24157993 ~ 24264287 (-)
naxd LOC106582132 coding downstream 828715 24141838 ~ 24147986 (-)
LOC110501610 LOC106582126 coding upstream 122234 25099441 ~ 25149856 (-)
LOC110501612 LOC107389858 coding upstream 185982 25163189 ~ 25176805 (-)
LOC118943630 NA coding upstream 254054 25231261 ~ 25234195 (-)
LOC110501615 LOC106582053 coding upstream 296661 25273868 ~ 25278632 (-)
LOC110501616 LOC106582122 coding upstream 324612 25299369 ~ 25311767 (-)
G1792428 NA non-coding downstream 39 24976223 ~ 24976662 (-)
G1792422 NA non-coding downstream 5407 24971061 ~ 24971294 (-)
G1792419 NA non-coding downstream 6911 24969579 ~ 24969790 (-)
G1792418 NA non-coding downstream 7679 24968645 ~ 24969022 (-)
G1792414 NA non-coding downstream 17753 24958706 ~ 24958948 (-)
G1792446 NA non-coding upstream 26516 25003723 ~ 25003947 (-)
G1792448 NA non-coding upstream 34393 25011600 ~ 25013698 (-)
G1792462 NA non-coding upstream 58120 25035327 ~ 25035791 (-)
G1792509 NA non-coding upstream 115061 25092268 ~ 25094151 (-)
G1792471 NA non-coding upstream 118285 25095492 ~ 25096562 (-)
G1792345 NA other downstream 118816 24856824 ~ 24857885 (-)
G1792342 LOC106582127 other downstream 126949 24848591 ~ 24849752 (-)
G1791405 NA other downstream 649574 24326729 ~ 24327127 (-)
LOC110501997 LOC106582152 other downstream 1516341 23368423 ~ 23460589 (-)
G1790280 NA other downstream 1807338 23164481 ~ 23169363 (-)
G1792433 NA other upstream 8752 24985959 ~ 24986268 (-)
LOC110501627 LOC106582113 other upstream 733366 25709599 ~ 25744218 (-)
G1794978 NA other upstream 2291455 27268662 ~ 27286095 (-)
LOC110501685 LOC106582064 other upstream 2764165 27741372 ~ 27770708 (-)
G1795850 NA other upstream 3003457 27980664 ~ 27981379 (-)

Expression


G1792429 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1792429 Expression in each Bioproject

Bar chart with 20 bars.
G1792429 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network