G1794978



Basic Information


Item Value
gene id G1794978
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 27268662 ~ 27286095 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2054267
tccataaaaaatgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatatgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagcctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2054267 True 603 TUCP 0.44 2 27268662 27286095
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110501663 LOC106582084 coding downstream 81824 27149329 ~ 27186838 (-)
LOC110501659 NA coding downstream 325434 26939760 ~ 26943228 (-)
LOC118943583 cenpj coding downstream 331978 26933520 ~ 26944274 (-)
LOC110501658 cenpj coding downstream 334816 26922840 ~ 26933846 (-)
LOC110502078 LOC106582090 coding downstream 355356 26805418 ~ 26913306 (-)
LOC110501665 NA coding upstream 54738 27340833 ~ 27364593 (-)
LOC110502080 wars2 coding upstream 84972 27371067 ~ 27437479 (-)
LOC110501670 LOC106582076 coding upstream 206379 27492474 ~ 27498625 (-)
LOC110501672 NA coding upstream 215596 27501691 ~ 27517629 (-)
LOC110501675 LOC106582077 coding upstream 253369 27539464 ~ 27544582 (-)
G1794952 NA non-coding downstream 34014 27229272 ~ 27234648 (-)
G1794953 NA non-coding downstream 37083 27230537 ~ 27231579 (-)
G1794920 LOC106582083 non-coding downstream 65562 27201316 ~ 27203100 (-)
G1794919 LOC106582083 non-coding downstream 74925 27193319 ~ 27193737 (-)
G1794938 NA non-coding downstream 80356 27188033 ~ 27188306 (-)
G1795020 NA non-coding upstream 42759 27328854 ~ 27329502 (-)
G1795090 NA non-coding upstream 95773 27381868 ~ 27382072 (-)
G1795096 NA non-coding upstream 98957 27385052 ~ 27385280 (-)
G1795098 NA non-coding upstream 100726 27386821 ~ 27387042 (-)
LOC110501627 LOC106582113 other downstream 1557043 25709599 ~ 25744218 (-)
G1792433 NA other downstream 2282394 24985959 ~ 24986268 (-)
G1792345 NA other downstream 2410777 24856824 ~ 24857885 (-)
G1792342 LOC106582127 other downstream 2418910 24848591 ~ 24849752 (-)
G1791405 NA other downstream 2941535 24326729 ~ 24327127 (-)
LOC110501685 LOC106582064 other upstream 455277 27741372 ~ 27770708 (-)
G1795850 NA other upstream 694569 27980664 ~ 27981379 (-)
LOC110501691 LOC106582059 other upstream 723560 28009421 ~ 28019116 (-)
G1796204 NA other upstream 1048129 28334224 ~ 28334621 (-)
G1796239 NA other upstream 1148820 28434915 ~ 28451815 (-)

Expression


G1794978 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1794978 Expression in each Bioproject

Bar chart with 19 bars.
G1794978 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network