G1795850



Basic Information


Item Value
gene id G1795850
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 27980664 ~ 27981379 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2055231
tctgagccctctcctgtactccctgttcacccacgactgcgtggccatgcacgcctccaactcaatcatcaagtttgcagacaacactacagtggtaggcttgattaccaacaacgacgagacggcctacagggaggaggtgagggccctcggagtgtggtgtcaggaaaataccacacactcaacgtcaacaaaacaaaggagatgattgtggatttcaggaaacagcagatggagcacccccatatccacatcgatgggacagtagtggagagggtagtaagttttaagttcctcggtgtacacatcacggacaaacagaattggtccacccatacagacagcgtggtgaagaaggcgcagcagagcctcttcaacctcaggaggctgaagaaatttggcttgtcaccaaaagcactcacaaacttttacagatgcacaatcgagagcatcctgtcgggctgctggtacggcaactgctccgcccacaaccgtaaggctctccagagggtagtgaggtctgcacaacgcatcacggggggcaaactacctgccctccaggacatctacaccacccaatgtcacaggaaggccataaagatcatcaaggacaacaaccacccaagccactgcctgttcaccccgctatcatccagaaggcgaggtcagtacaggtgcatcaaagcagggaccgagattctgaaaaacagcttcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2055231 True 716 TUCP 0.52 1 27980664 27981379
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110501689 LOC106582060 coding downstream 67745 27903582 ~ 27912919 (-)
acbp acbp coding downstream 142091 27834422 ~ 27838573 (-)
LOC110501686 LOC106582063 coding downstream 163541 27776571 ~ 27817123 (-)
LOC110501685 LOC106582064 coding downstream 209956 27741372 ~ 27770708 (-)
LOC110502082 LOC106582065 coding downstream 240034 27706931 ~ 27740630 (-)
LOC110501691 LOC106582059 coding upstream 28042 28009421 ~ 28019116 (-)
LOC110502083 LOC101162407 coding upstream 77514 28058893 ~ 28062683 (-)
LOC110501696 LOC106582163 coding upstream 557326 28538705 ~ 28548565 (-)
trnan-guu-200 NA coding upstream 738680 28720059 ~ 28720298 (-)
LOC110501699 NA coding upstream 837951 28819330 ~ 28826708 (-)
G1795777 LOC106582058 non-coding downstream 45380 27931039 ~ 27935284 (-)
G1795771 NA non-coding downstream 115576 27864643 ~ 27865088 (-)
G1795708 LOC106582078 non-coding downstream 292092 27683080 ~ 27688572 (-)
G1795707 NA non-coding downstream 298226 27682175 ~ 27682438 (-)
G1795871 NA non-coding upstream 42359 28023738 ~ 28023937 (-)
G1795885 LOC106582057 non-coding upstream 62872 28044251 ~ 28044507 (-)
G1795896 LOC106582055 non-coding upstream 91496 28072875 ~ 28075589 (-)
G1795914 NA non-coding upstream 114050 28095429 ~ 28095647 (-)
G1795920 NA non-coding upstream 124348 28105727 ~ 28105945 (-)
G1794978 NA other downstream 694569 27268662 ~ 27286095 (-)
LOC110501627 LOC106582113 other downstream 2269045 25709599 ~ 25744218 (-)
G1792433 NA other downstream 2994396 24985959 ~ 24986268 (-)
G1792345 NA other downstream 3122779 24856824 ~ 24857885 (-)
G1796204 NA other upstream 352845 28334224 ~ 28334621 (-)
G1796239 NA other upstream 453536 28434915 ~ 28451815 (-)
G1796401 NA other upstream 644759 28626138 ~ 28626891 (-)

Expression


G1795850 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1795850 Expression in each Bioproject

Bar chart with 20 bars.
G1795850 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network