G1795914



Basic Information


Item Value
gene id G1795914
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 28095429 ~ 28095647 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2055301
CAGCGTTATACAATGTGTACCCATTGCCCAGTTCATGGTGCTTTGTCCCGAAGGCAAACCAAGGAAAATTTTAATTTCTCCTCTTCTAAATCGCTCGGAGGAACCCAATTTCTGTGCCTTTGTAGCCAGCACAAAAAGACATTAATACAATCCACAGGCAGAGTGGAGAGGGCCGTACGTAACTGGCCTAGTTTTGGGGAGTGTGTAGATTAATAAAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2055301 True 219 lncRNA 0.44 1 28095429 28095647

Neighbor


gene id symbol gene type direction distance location
LOC110502083 LOC101162407 coding downstream 32746 28058893 ~ 28062683 (-)
LOC110501691 LOC106582059 coding downstream 76313 28009421 ~ 28019116 (-)
LOC110501689 LOC106582060 coding downstream 182510 27903582 ~ 27912919 (-)
acbp acbp coding downstream 256856 27834422 ~ 27838573 (-)
LOC110501686 LOC106582063 coding downstream 278306 27776571 ~ 27817123 (-)
LOC110501696 LOC106582163 coding upstream 443058 28538705 ~ 28548565 (-)
trnan-guu-200 NA coding upstream 624412 28720059 ~ 28720298 (-)
LOC110501699 NA coding upstream 723683 28819330 ~ 28826708 (-)
LOC118943585 NA coding upstream 1228498 29324145 ~ 29325269 (-)
LOC110501708 LOC106582177 coding upstream 1337905 29433552 ~ 29441071 (-)
G1795896 LOC106582055 non-coding downstream 19840 28072875 ~ 28075589 (-)
G1795885 LOC106582057 non-coding downstream 50922 28044251 ~ 28044507 (-)
G1795871 NA non-coding downstream 71492 28023738 ~ 28023937 (-)
G1795777 LOC106582058 non-coding downstream 160145 27931039 ~ 27935284 (-)
G1795771 NA non-coding downstream 230341 27864643 ~ 27865088 (-)
G1795920 NA non-coding upstream 10080 28105727 ~ 28105945 (-)
G1795923 NA non-coding upstream 13857 28109504 ~ 28109880 (-)
G1795929 NA non-coding upstream 24881 28120528 ~ 28121557 (-)
G1795931 NA non-coding upstream 28394 28124041 ~ 28124253 (-)
G1795944 NA non-coding upstream 46823 28142470 ~ 28143938 (-)
G1795850 NA other downstream 114050 27980664 ~ 27981379 (-)
LOC110501685 LOC106582064 other downstream 351830 27741372 ~ 27770708 (-)
G1794978 NA other downstream 809334 27268662 ~ 27286095 (-)
LOC110501627 LOC106582113 other downstream 2383810 25709599 ~ 25744218 (-)
G1796204 NA other upstream 238577 28334224 ~ 28334621 (-)
G1796239 NA other upstream 339268 28434915 ~ 28451815 (-)
G1796401 NA other upstream 530491 28626138 ~ 28626891 (-)
G1797146 LOC106582182 other upstream 1116017 29211664 ~ 29243649 (-)

Expression


G1795914 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1795914 Expression in each Bioproject

Bar chart with 2 bars.
G1795914 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network