G1795929



Basic Information


Item Value
gene id G1795929
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 28120528 ~ 28121557 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2055316
AGTCATATCCCACTGAGTCATATCCCACTGAGTCATATCCCACTGAGTCATATCTCACTGAGTCAAATCCCACTGAGTCATATCCCACTGAGTCATATCCCACTGAGTCATATCCCACTGAGTCATATCCCACTGAGTCATATTTCACTGAGTCATATCCCACTGAGTCATATTTCACTGAGTCATATTTCACTGAGTCATATCCCACTGAGTCATATTTCACTGAGTCATATCCCACTAAGTCATATTTCACTGAGTCATATCCCACTGAGTCATATTTCACTGAGTCATATTTCACTGAGTCATATCCCACTGAGTCATATTTCACTGAGTCATATCCCACTAAGTCATATTTCACTGAGTCATATCCCACTGAGTCATATCCCACTGAGTCATATTTCACTGAGTCATATCCCACTGAGTCTTATCACACTGAATCGTATCACAAATATTGAAATATTCACGTTTGTCTTTAAAGAGACAACACATTAAAGGGTACAACTATAATATAATTACGTCC

Function


NR:

description
PREDICTED: putative mediator of RNA polymerase II transcription subunit 12

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2055316 True 520 lncRNA 0.39 3 28120528 28121557

Neighbor


gene id symbol gene type direction distance location
LOC110502083 LOC101162407 coding downstream 57845 28058893 ~ 28062683 (-)
LOC110501691 LOC106582059 coding downstream 101412 28009421 ~ 28019116 (-)
LOC110501689 LOC106582060 coding downstream 207609 27903582 ~ 27912919 (-)
acbp acbp coding downstream 281955 27834422 ~ 27838573 (-)
LOC110501686 LOC106582063 coding downstream 303405 27776571 ~ 27817123 (-)
LOC110501696 LOC106582163 coding upstream 417148 28538705 ~ 28548565 (-)
trnan-guu-200 NA coding upstream 598502 28720059 ~ 28720298 (-)
LOC110501699 NA coding upstream 697773 28819330 ~ 28826708 (-)
LOC118943585 NA coding upstream 1202588 29324145 ~ 29325269 (-)
LOC110501708 LOC106582177 coding upstream 1311995 29433552 ~ 29441071 (-)
G1795923 NA non-coding downstream 10648 28109504 ~ 28109880 (-)
G1795920 NA non-coding downstream 14583 28105727 ~ 28105945 (-)
G1795914 NA non-coding downstream 24881 28095429 ~ 28095647 (-)
G1795896 LOC106582055 non-coding downstream 44939 28072875 ~ 28075589 (-)
G1795885 LOC106582057 non-coding downstream 76021 28044251 ~ 28044507 (-)
G1795931 NA non-coding upstream 2484 28124041 ~ 28124253 (-)
G1795944 NA non-coding upstream 20913 28142470 ~ 28143938 (-)
G1795954 NA non-coding upstream 26752 28148309 ~ 28164518 (-)
G1795955 NA non-coding upstream 45224 28166781 ~ 28167069 (-)
G1796139 NA non-coding upstream 51207 28172764 ~ 28174542 (-)
G1795850 NA other downstream 139149 27980664 ~ 27981379 (-)
LOC110501685 LOC106582064 other downstream 376929 27741372 ~ 27770708 (-)
G1794978 NA other downstream 834433 27268662 ~ 27286095 (-)
LOC110501627 LOC106582113 other downstream 2408909 25709599 ~ 25744218 (-)
G1796204 NA other upstream 212667 28334224 ~ 28334621 (-)
G1796239 NA other upstream 313358 28434915 ~ 28451815 (-)
G1796401 NA other upstream 504581 28626138 ~ 28626891 (-)
G1797146 LOC106582182 other upstream 1090107 29211664 ~ 29243649 (-)

Expression



Co-expression Network