G1796503



Basic Information


Item Value
gene id G1796503
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 28715027 ~ 28715304 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2055944
agtagttggaggccacagaaggagtgttgtatggcattgaagctcgtctggaggtttgttaacacagtgtccaaagaagggccagatgtttacagaatggtgtcatctgcgtagaggtggatcaaagagtaacccgcagcaagagcaacatcattgatatatacagagaaaagagtctgcccgagaattgaaccctgtggcacccccatggagactgccagaggtccagacaacaggccctccgatttgacacactgaattctatctgagaagtagtt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2055944 True 278 lncRNA 0.48 1 28715027 28715304

Neighbor


gene id symbol gene type direction distance location
LOC110501697 LOC106582162 coding upstream 12363 28701867 ~ 28702664 (+)
LOC110502084 NA coding upstream 318677 28236220 ~ 28400108 (+)
trnaa-ugc-174 NA coding upstream 424730 28290225 ~ 28290297 (+)
LOC110501694 LOC106582055 coding upstream 638456 28072420 ~ 28076571 (+)
LOC110501693 LOC106582057 coding upstream 663008 28036917 ~ 28052019 (+)
epha6 LOC106582188 coding downstream 40486 28755790 ~ 28976739 (+)
LOC110502085 LOC106582160 coding downstream 264914 28977890 ~ 28984226 (+)
LOC110502121 cld14 coding downstream 278029 28993333 ~ 28994549 (+)
LOC110501700 LOC106582186 coding downstream 282459 28997763 ~ 29010281 (+)
LOC110501701 LOC106586531 coding downstream 348335 29063639 ~ 29094498 (+)
G1796500 NA non-coding upstream 2519 28712202 ~ 28712508 (+)
G1796461 NA non-coding upstream 41906 28672918 ~ 28673121 (+)
G1796440 NA non-coding upstream 55191 28659598 ~ 28659836 (+)
G1796436 NA non-coding upstream 56753 28658045 ~ 28658274 (+)
G1796412 NA non-coding upstream 72830 28641899 ~ 28642197 (+)
G1796505 NA non-coding downstream 1760 28717064 ~ 28717353 (+)
G1796520 NA non-coding downstream 21691 28736995 ~ 28737221 (+)
G1796537 NA non-coding downstream 34480 28749784 ~ 28749986 (+)
G1796555 NA non-coding downstream 45430 28760734 ~ 28765709 (+)
G1796567 NA non-coding downstream 76300 28791604 ~ 28792044 (+)
G1795550 NA other upstream 622911 28091565 ~ 28092116 (+)
G1795411 NA other upstream 802152 27898367 ~ 27912875 (+)
G1793717 NA other upstream 2398784 26315826 ~ 26316243 (+)
G1793045 NA other upstream 2983273 25731326 ~ 25731754 (+)
G1797582 NA other downstream 1028888 29744192 ~ 29744854 (+)
LOC118943632 LOC100194703 other downstream 1208253 29917773 ~ 29933035 (+)
G1798168 NA other downstream 1785352 30500656 ~ 30545954 (+)

Expression


G1796503 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1796503 Expression in each Bioproject

Bar chart with 20 bars.
G1796503 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network