G1806014



Basic Information


Item Value
gene id G1806014
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 36280386 ~ 36287356 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2066268
tgtaattgtcctggtgtcatattgtcctagtgtaattgtcctagtataattgtcctagtgtcatattgtcctagtataattgtcctggtgtcatattgtcctagtgtaattgtcctagtgtcatattgtcctagtataattgtcctagtgtcatattgtcctagtgtaattgtcctagtataattgtcctggtgtcatattgtcctagtgtaattgtcctagtataattgtcctggtgtcatattgtcctagtgtcatattgtcctagtgtaattgtcctagtataattgtcctagtgtcatattgtcctagtgtaattgtcctagtataattgtcctagtgtcatattgtcctagtgtaattgtcctagtataattgtcctggtgtcatattgtcctagtgtaattgtcctagtataattgtcctggtgtcatattgtcctagtataattgtcctagtgtcatattgtcctagtataattgtcctagtgtcatattgtcctagtataattgtcctagtgtcatattgtcctagtataattgtcctagtgtcatattgtcctagtgtaatattgtcctggtgtcatattgtcctagtgtaattgtcctagtataattgtcctagtgtcatcttgt

Function


NR:

description
PREDICTED: uncharacterized protein LOC106588136 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2066268 True 635 lncRNA 0.35 2 36280386 36287356

Neighbor


gene id symbol gene type direction distance location
nifk mk67i coding downstream 48296 36228361 ~ 36232090 (-)
LOC118943733 NA coding downstream 49110 36231149 ~ 36231276 (-)
LOC118943734 NA coding downstream 50955 36229306 ~ 36229431 (-)
LOC110502096 LOC106582358 coding downstream 52257 36106047 ~ 36228129 (-)
tfcp2l1 tf2l1 coding downstream 177491 36093188 ~ 36102895 (-)
hspbap1 hspbap1 coding upstream 118385 36405741 ~ 36441362 (-)
LOC110501806 sema5b coding upstream 265342 36552698 ~ 36837583 (-)
LOC110501809 adcy5 coding upstream 692740 36980096 ~ 37099621 (-)
hacd2 hacd2 coding upstream 818129 37105485 ~ 37117837 (-)
LOC110501816 LOC106582342 coding upstream 1070788 37358144 ~ 37390316 (-)
G1805967 tsn non-coding downstream 32573 36243199 ~ 36247813 (-)
G1805983 NA non-coding downstream 60915 36218741 ~ 36219471 (-)
G1805937 NA non-coding downstream 170572 36085336 ~ 36109814 (-)
G1805922 LOC106582360 non-coding downstream 224687 36055355 ~ 36055699 (-)
G1805920 NA non-coding downstream 227378 36052792 ~ 36053008 (-)
G1806050 NA non-coding upstream 55801 36343157 ~ 36345530 (-)
G1806092 NA non-coding upstream 154345 36441701 ~ 36512450 (-)
G1806177 NA non-coding upstream 282258 36569614 ~ 36657977 (-)
G1806206 NA non-coding upstream 324862 36612218 ~ 36612522 (-)
G1806316 NA non-coding upstream 502399 36789755 ~ 36789992 (-)
G1805927 LOC106582360 other downstream 220618 36057844 ~ 36059768 (-)
LOC110502094 LOC106582301 other downstream 1060687 35138330 ~ 35471205 (-)
G1803964 NA other downstream 1153553 35126479 ~ 35126833 (-)
bard1 bard1 other downstream 1740213 34473620 ~ 34544232 (-)
G1801331 NA other downstream 3319901 32958322 ~ 32960485 (-)
G1806393 NA other upstream 648302 36935658 ~ 36936087 (-)
G1806449 NA other upstream 756205 37043561 ~ 37112474 (-)
G1807020 LOC105030512 other upstream 1472615 37759971 ~ 37760248 (-)
G1807750 LOC106582372 other upstream 1906066 38193422 ~ 38195096 (-)

Expression


G1806014 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1806014 Expression in each Bioproject

Bar chart with 8 bars.
G1806014 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 350.
End of interactive chart.

Co-expression Network