G1813017



Basic Information


Item Value
gene id G1813017
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048586.1
NCBI id CM023240.2
chromosome length 52474311
location 43210127 ~ 43210763 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2074107
aggtagtgcaggatcttgaaggagagactggagtagtagcgctcaccagtagccctccgcttactgacgagctctggccttttactggacatgaagtgacaaaatgaccagcggaaccgcaatagagacagaggcggttggtgattctccgttccctctccttagtcgagatgcggatacctcccagctgcatgggctcagcacccgagccggcagaggaagatggtagtgatgcggagaggggggcgacggagagcgcgagctcctttccacaagctcggtgacgaagatcaacccgtcgctcaatgcgaatagcgagttcaatcaaggaatccacgctggaaggaacctcccgggagagaatctcatcctttacctctgcgcggagaccctccagaagacgagcgagcaaggccggctcgttccagccactggagacagcaagagtgcgaaactcaatagagtagtctgttatggatcgattgccttgacatagggaagacagggccctggaagcctcctccccaaaaacagatcgatcaaaaacccgtatcatctcctccttaaagtcctgatactggttagtacactcagcccttgcctcccagattgccgtgccccactcacgagcccgtcc

Function


NR:

description
Retrotransposon-derived protein PEG10

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2074107 True 637 lncRNA 0.56 1 43210127 43210763
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110501901 LOC106582440 coding upstream 172133 42884711 ~ 43039681 (+)
LOC110502157 LOC106582435 coding upstream 475565 42688215 ~ 42735867 (+)
LOC110502156 ahr2a coding upstream 525019 42615178 ~ 42685108 (+)
LOC110501894 glpc coding upstream 659157 42511973 ~ 42550970 (+)
LOC110501889 LOC106582433 coding upstream 820659 42256417 ~ 42389468 (+)
LOC110501905 LOC106582444 coding downstream 3077 43213840 ~ 43226393 (+)
LOC110501904 LOC106582430 coding downstream 19661 43230424 ~ 43232133 (+)
LOC110501906 LOC106582445 coding downstream 136040 43346803 ~ 43486763 (+)
LOC110501907 LOC106582447 coding downstream 291030 43501793 ~ 43549935 (+)
LOC110501909 LOC106582448 coding downstream 339709 43550472 ~ 43572947 (+)
G1813008 NA non-coding upstream 8826 43201047 ~ 43201301 (+)
G1812930 NA non-coding upstream 74574 43135337 ~ 43135553 (+)
G1812915 NA non-coding upstream 87893 43122006 ~ 43122234 (+)
G1812896 NA non-coding upstream 101012 43108800 ~ 43109115 (+)
G1812895 NA non-coding upstream 101347 43108516 ~ 43108780 (+)
G1813071 NA non-coding downstream 73510 43284273 ~ 43291106 (+)
G1813123 NA non-coding downstream 147671 43358434 ~ 43359555 (+)
G1813094 NA non-coding downstream 175198 43385961 ~ 43389375 (+)
G1813143 NA non-coding downstream 191920 43402683 ~ 43402885 (+)
G1813144 NA non-coding downstream 192177 43402940 ~ 43403259 (+)
G1812953 NA other upstream 59743 43149762 ~ 43150384 (+)
G1812428 NA other upstream 486013 42723672 ~ 42724114 (+)
G1810740 NA other upstream 1743778 41464478 ~ 41466349 (+)
G1813442 NA other downstream 897481 44108244 ~ 44110867 (+)
LOC110502169 LOC106582455 other downstream 1107395 44148629 ~ 44324651 (+)
G1813588 ino80d other downstream 1151898 44362661 ~ 44371923 (+)
G1813665 LOC106582464 other downstream 1287694 44498457 ~ 44508051 (+)
LOC110501918 LOC106582467 other downstream 1356125 44566863 ~ 44573921 (+)

Expression


G1813017 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1813017 Expression in each Bioproject

Bar chart with 20 bars.
G1813017 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network