LOC118943946



Basic Information


Item Value
gene id LOC118943946
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 47504131 ~ 47504255 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005039291.1
TACCCATGTTAAACGTTTGGGCCCAGCTGTTGTCTGGGGTGAGTTTACTAGGTCTATAGTACTGGTACATTAAGCTAATTGCCTGCTCTTTATAGCAGAGGGATTAAACCCATGTGCCCCCTCAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005039291.1 True 125 mRNA 0.46 1 47504131 47504255

Neighbor


gene id symbol gene type direction distance location
LOC118943950 NA coding upstream 263 47503741 ~ 47503868 (+)
LOC118943945 NA coding upstream 1126 47502878 ~ 47503005 (+)
LOC110502883 LOC106609499 coding upstream 2730 47471182 ~ 47501401 (+)
LOC110502887 NA coding upstream 34215 47467771 ~ 47470803 (+)
LOC110502886 LOC106609527 coding upstream 42742 47458529 ~ 47461389 (+)
LOC110502889 snx29 coding downstream 14367 47518622 ~ 47694219 (+)
LOC110502891 LOC106609556 coding downstream 390080 47894335 ~ 47933015 (+)
LOC110502893 LOC106609573 coding downstream 502921 48007176 ~ 48021129 (+)
LOC110502895 LOC106609599 coding downstream 580483 48084738 ~ 48089012 (+)
LOC100135792 LOC100135792 coding downstream 838152 48342407 ~ 48343186 (+)
G1872843 NA non-coding upstream 78251 47408169 ~ 47425880 (+)
G1872844 NA non-coding upstream 80576 47423003 ~ 47423555 (+)
G1872842 NA non-coding upstream 98311 47404470 ~ 47405820 (+)
LOC110503127 LOC106609422 non-coding upstream 188517 47312009 ~ 47374126 (+)
G1872783 NA non-coding upstream 248973 47254873 ~ 47255158 (+)
G1873468 NA non-coding downstream 216097 47720352 ~ 47720689 (+)
G1873506 NA non-coding downstream 246431 47750686 ~ 47750978 (+)
G1873545 NA non-coding downstream 276901 47781156 ~ 47781474 (+)
G1873546 NA non-coding downstream 277900 47782155 ~ 47782369 (+)
G1873551 NA non-coding downstream 281090 47785345 ~ 47787367 (+)
LOC110502882 csnk1d other upstream 116440 47374444 ~ 47435736 (+)
LOC110502861 LOC106608955 other upstream 600559 46896695 ~ 46903585 (+)
G1871170 NA other upstream 884445 46616135 ~ 46619686 (+)
G1873717 LOC106609588 other downstream 536339 48040594 ~ 48042832 (+)
G1875567 NA other downstream 2248833 49753088 ~ 49753438 (+)
G1875689 LOC100136012 other downstream 2544931 50049186 ~ 50050036 (+)
G1875816 NA other downstream 2739305 50243560 ~ 50244524 (+)

Expression


LOC118943946 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

LOC118943946 Expression in each Bioproject

Bar chart with 9 bars.
LOC118943946 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network