G1822183



Basic Information


Item Value
gene id G1822183
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 2066060 ~ 2066614 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2085756
actgttgactgtgtgatggatggatgtataggtctaccaaccatactgttgactgtctgatggatggatgtataggtccaccaaccatactgttgactgtctatggatgtataggtctaccaaccatactgttgactgtctaatggatgggtgtataggtctaccaaccatactgttgactgtctgatggatggatgtataggtctaccaaccatactgttgactgtctaatggatgtataggtctaccaaccatactgttgactgtctaatggatggatgtatagggctaccaaccatactgttgactgtgtgatggatggatgtataggtctaccaaccatactgttgactgtctgatggatggatgtataggtccaccaaccatactgttgactgtctatggatgtataggtctaccaaccatac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2085756 True 428 lncRNA 0.43 2 2066060 2066614
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110513647 LOC106577307 coding upstream 280807 1780957 ~ 1785253 (+)
exoc6 exoc6 coding upstream 302042 1624386 ~ 1764018 (+)
hhex hhex coding upstream 499896 1562972 ~ 1566164 (+)
LOC110516888 LOC106577303 coding upstream 777632 1124471 ~ 1288428 (+)
LOC110517143 LOC106577302 coding upstream 948884 1113638 ~ 1117176 (+)
LOC118943846 LOC106613874 coding downstream 183278 2249824 ~ 2250254 (+)
LOC110511819 LOC100194495 coding downstream 247144 2313758 ~ 2316741 (+)
LOC110513179 LOC106593625 coding downstream 463842 2530456 ~ 2541369 (+)
LOC118943864 NA coding downstream 494433 2558920 ~ 2566321 (+)
LOC118943820 NA coding downstream 500440 2567054 ~ 2567312 (+)
G1822175 NA non-coding upstream 12356 2053221 ~ 2053704 (+)
G1822158 NA non-coding upstream 21932 2021065 ~ 2044128 (+)
G1822169 NA non-coding upstream 27024 2038315 ~ 2039036 (+)
G1822168 NA non-coding upstream 27802 2037923 ~ 2038258 (+)
G1822164 NA non-coding upstream 34883 2030859 ~ 2031177 (+)
G1822192 NA non-coding downstream 14819 2081433 ~ 2086026 (+)
G1822197 NA non-coding downstream 30731 2097345 ~ 2104676 (+)
G1822213 NA non-coding downstream 99636 2166250 ~ 2167766 (+)
LOC110512159 LOC106591006 non-coding downstream 110153 1934753 ~ 2203012 (+)
G1822221 NA non-coding downstream 177704 2244318 ~ 2245137 (+)
G1822059 NA other upstream 197553 1868008 ~ 1868507 (+)
G1821637 LOC106577436 other upstream 756756 1306706 ~ 1309304 (+)
G1820989 NA other upstream 1728744 336747 ~ 337316 (+)
LOC110519474 mtr other upstream 1811222 196406 ~ 274981 (+)
LOC110514481 LOC106604002 other downstream 510504 2576948 ~ 2647345 (+)
LOC110510594 ank3 other downstream 587141 2653755 ~ 2923588 (+)
G1822610 NA other downstream 688603 2755217 ~ 2761850 (+)
G1822758 NA other downstream 1191594 3258208 ~ 3269559 (+)

Expression


G1822183 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1822183 Expression in each Bioproject

Bar chart with 19 bars.
G1822183 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network