G1822610


Basic Information

Item Value
gene id G1822610
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 2755217 ~ 2761850 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2086367
gggatgttactgtagtagatattaatagggatgttactgtagtagatattaacagggatgttactgtagtagatatgaacattaacagggatgttactgtagtagatatgaatagggatgttactgtagtagatattaacagggatgttactgtagtagatatgaacattaatagggatgttactgtagtagatatgaacattaacagggatgttactgtagtagatatgaacagggatgttactgtagtagatatgaatagggatgttactgtagtagatatgaacagggatgttactgtagtagatatgaatagggatgttactgtagtagatattaatagggatgttactgtagtagatatgaacattaacagggatgttactgtagtagatattaatagggatgttactgtagtagatatgaacattaatagggatgttactgtatta
>TU2086366
agggatgttactgtagtagatatgaacattaacagggatgttactgtagtagatatgaatagggatgttactgtagtagatattaatagggatgttactgtagtagatattaacagggatgttactgtagtagatatgaacattaatagggatgttactgtagtagatatgaatagggatgttactgtagtagatatgaacatgaatagggatgttactgtagtagatatgaacattaacagggatgtgaCTAGTAGATattaatagggatgttactgtagtagatatgaacagggatgttactgtagtagatatgaacagggatgttactgtagtagatatgaatagggatgttactgtagtagatatgaacattaacagggatgttactgtagtagatatgaacagggatgttactgtagtatatatgaatagggatgttactgtagtagatatgaacagggatgttactgtagtatatatgaatagggatgttactgtagtagatatgaaca

Function

NR:

description
putative uncharacterized protein DDB_G0282133 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2086367 False 452 TUCP 0.33 3 2755217 2761850
TU2086366 True 515 lncRNA 0.33 3 2757448 2760573

Neighbor

gene id symbol gene type direction distance location
LOC110514481 LOC106604002 coding upstream 110103 2576948 ~ 2647345 (+)
LOC118943820 NA coding upstream 190136 2567054 ~ 2567312 (+)
LOC118943864 NA coding upstream 195704 2558920 ~ 2566321 (+)
LOC110513179 LOC106593625 coding upstream 216079 2530456 ~ 2541369 (+)
LOC110511819 LOC100194495 coding upstream 440707 2313758 ~ 2316741 (+)
LOC118943875 NA coding downstream 155406 2915979 ~ 2917430 (+)
LOC110514011 LOC106577402 coding downstream 214963 2975536 ~ 2990707 (+)
LOC110518873 LOC106598281 coding downstream 257889 3018462 ~ 3021528 (+)
LOC110518782 LOC105026310 coding downstream 276915 3037488 ~ 3094262 (+)
LOC118943854 NA coding downstream 665486 3426059 ~ 3430104 (+)
G1822564 NA non-coding upstream 14836 2649179 ~ 2742612 (+)
G1822563 LOC106591053 non-coding upstream 18648 2737224 ~ 2738800 (+)
G1822561 NA non-coding upstream 121983 2634134 ~ 2635465 (+)
G1822637 NA non-coding downstream 89402 2849975 ~ 2851713 (+)
G1822640 NA non-coding downstream 100587 2861160 ~ 2862447 (+)
G1822642 NA non-coding downstream 143441 2904014 ~ 2905911 (+)
G1822643 NA non-coding downstream 147007 2907580 ~ 2908607 (+)
G1822644 NA non-coding downstream 150968 2911541 ~ 2955902 (+)
LOC110512159 LOC106591006 other upstream 623259 1934753 ~ 2203012 (+)
G1822059 NA other upstream 888941 1868008 ~ 1868507 (+)
G1821637 LOC106577436 other upstream 1448144 1306706 ~ 1309304 (+)
LOC110516888 LOC106577303 other upstream 1597596 1124471 ~ 1288428 (+)
G1822758 NA other downstream 497635 3258208 ~ 3269559 (+)
G1822769 NA other downstream 519119 3279692 ~ 3280453 (+)
G1822927 NA other downstream 988131 3748704 ~ 3749129 (+)
G1823015 NA other downstream 1032399 3792972 ~ 3797118 (+)
G1822905 LOC100136344 other downstream 1140233 3900806 ~ 3918363 (+)

Expression

G1822610 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1822610 Expression in each Bioproject

Bar chart with 16 bars.
G1822610 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network