G1822761



Basic Information


Item Value
gene id G1822761
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 3246890 ~ 3247145 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2086561
gaccaggtgcacacgggtcttttgggtgaccaggtgcacacgggtcttttgggtgaccaggtgcacacgggtcttttgggtgaccaggtgcacatgggattaatagcaatctgcatccatcgcaatttcttaaagtgcccataaagcaccaaggacggccccgaccgagacagggccgtagtggggcactcccctagcgggctatagcaatagaatgacgggtaaaaatatttaaaaccgttttataaattttggg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2086561 True 256 lncRNA 0.51 1 3246890 3247145

Neighbor


gene id symbol gene type direction distance location
LOC110518782 LOC105026310 coding upstream 152628 3037488 ~ 3094262 (+)
LOC110518873 LOC106598281 coding upstream 225362 3018462 ~ 3021528 (+)
LOC110514011 LOC106577402 coding upstream 256183 2975536 ~ 2990707 (+)
LOC110510594 ank3 coding upstream 323302 2653755 ~ 2923588 (+)
LOC118943854 NA coding downstream 178914 3426059 ~ 3430104 (+)
LOC118943944 NA coding downstream 411875 3659020 ~ 3659154 (+)
LOC110531516 LOC106597820 coding downstream 447218 3694363 ~ 3702585 (+)
LOC110513996 xpo1b coding downstream 461770 3708915 ~ 3779869 (+)
LOC118943889 NA coding downstream 705221 3950792 ~ 3953879 (+)
G1822760 NA non-coding upstream 3450 3243201 ~ 3243440 (+)
G1822757 NA non-coding upstream 3728 3235918 ~ 3243162 (+)
G1822756 NA non-coding upstream 4464 3235230 ~ 3242426 (+)
G1822753 NA non-coding upstream 26353 3220080 ~ 3220537 (+)
G1822752 NA non-coding upstream 29808 3216619 ~ 3217082 (+)
G1822762 NA non-coding downstream 1349 3248494 ~ 3251158 (+)
G1822763 NA non-coding downstream 5928 3253073 ~ 3253415 (+)
G1822764 NA non-coding downstream 9611 3256756 ~ 3266045 (+)
G1822765 NA non-coding downstream 14733 3261878 ~ 3270078 (+)
G1822768 NA non-coding downstream 31892 3279037 ~ 3279642 (+)
G1822610 NA other upstream 485040 2755217 ~ 2761850 (+)
LOC110514481 LOC106604002 other upstream 666076 2576948 ~ 2647345 (+)
LOC110512159 LOC106591006 other upstream 1112701 1934753 ~ 2203012 (+)
G1822059 NA other upstream 1378383 1868008 ~ 1868507 (+)
G1822758 NA other downstream 11063 3258208 ~ 3269559 (+)
G1822769 NA other downstream 32547 3279692 ~ 3280453 (+)
G1822927 NA other downstream 501559 3748704 ~ 3749129 (+)
G1823015 NA other downstream 545827 3792972 ~ 3797118 (+)
G1822905 LOC100136344 other downstream 653661 3900806 ~ 3918363 (+)

Expression


G1822761 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1822761 Expression in each Bioproject

Bar chart with 17 bars.
G1822761 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network