G1822955



Basic Information


Item Value
gene id G1822955
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 3624931 ~ 3625161 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2086835
tgtagggacggcagggtggcctagtggttagagtgtaggggcggcagggtagcctagtggttagagtgtaggggcggcagggtggcctagtggttagagtgtagggacggcagggtggcctagtggttagagtgtagggacggcagggtggcctagtggttagagtgtaggggcggcagggtagcctagtggttagagtgtaggggcggcagggtggcctagtggttagag

Function


NR:

description
PREDICTED: leucine-rich repeat extensin-like protein 5

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2086835 True 231 lncRNA 0.61 1 3624931 3625161
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118943854 NA coding upstream 194827 3426059 ~ 3430104 (+)
LOC110518782 LOC105026310 coding upstream 530669 3037488 ~ 3094262 (+)
LOC110518873 LOC106598281 coding upstream 603403 3018462 ~ 3021528 (+)
LOC110514011 LOC106577402 coding upstream 634224 2975536 ~ 2990707 (+)
LOC118943875 NA coding upstream 707501 2915979 ~ 2917430 (+)
LOC118943944 NA coding downstream 33859 3659020 ~ 3659154 (+)
LOC110531516 LOC106597820 coding downstream 69202 3694363 ~ 3702585 (+)
LOC110513996 xpo1b coding downstream 83754 3708915 ~ 3779869 (+)
LOC118943889 NA coding downstream 327205 3950792 ~ 3953879 (+)
LOC118943888 LOC106613810 coding downstream 352459 3977620 ~ 3997300 (+)
G1822951 NA non-coding upstream 7686 3616270 ~ 3617245 (+)
G1822945 NA non-coding upstream 23764 3599199 ~ 3601167 (+)
G1822863 NA non-coding upstream 37328 3501080 ~ 3587603 (+)
G1822885 NA non-coding upstream 85863 3538636 ~ 3539068 (+)
G1822869 NA non-coding upstream 107133 3517344 ~ 3517798 (+)
G1822961 NA non-coding downstream 11004 3636165 ~ 3640970 (+)
G1822981 NA non-coding downstream 45180 3670341 ~ 3670546 (+)
G1822983 NA non-coding downstream 60450 3685611 ~ 3686400 (+)
G1822986 NA non-coding downstream 64674 3689835 ~ 3690115 (+)
G1822988 NA non-coding downstream 71629 3696790 ~ 3697181 (+)
G1822769 NA other upstream 344478 3279692 ~ 3280453 (+)
G1822758 NA other upstream 355372 3258208 ~ 3269559 (+)
LOC110510594 ank3 other upstream 751575 2653755 ~ 2923588 (+)
G1822610 NA other upstream 863081 2755217 ~ 2761850 (+)
LOC110514481 LOC106604002 other upstream 1044117 2576948 ~ 2647345 (+)
G1822927 NA other downstream 123543 3748704 ~ 3749129 (+)
G1823015 NA other downstream 167811 3792972 ~ 3797118 (+)
G1822905 LOC100136344 other downstream 275645 3900806 ~ 3918363 (+)
G1823100 NA other downstream 379138 4004299 ~ 4005323 (+)
G1824228 NA other downstream 1180335 4805496 ~ 4819568 (+)

Expression


G1822955 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1822955 Expression in each Bioproject

Bar chart with 14 bars.
G1822955 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network