G1824784



Basic Information


Item Value
gene id G1824784
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 5720223 ~ 5720741 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2089365
tcactgtggatctatatgcaggaagtaccagatcaatgtggatctatatacaggaagtaccagatcaatgtggatctatatacaggaagtaccagatcaatgtggatctgtatacaggaagtaccagatcaatgtggaactatatacaggaagtaccagatcaatgtttatctatatacaggaagtaccagatcaatgtggatctatatacaggaagtaccagatcaatgtggagctatatacaggaagtatcagatcaatgtggagctatatacaggaagtaccagatccatgtggagctatatacaggaagtaccagatccatgtggagctatatacaggaagtaccagatcaatgtggagctatatacaggaagtaccagatcaatgtggagctatatacaggaagtaccagtaccagat

Function


NR:

description
PREDICTED: uncharacterized protein LOC106612170, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2089365 True 423 TUCP 0.39 2 5720223 5720741

Neighbor


gene id symbol gene type direction distance location
LOC118943907 NA coding upstream 367597 5350745 ~ 5352626 (+)
LOC110531814 clrn3 coding upstream 384793 5329119 ~ 5335430 (+)
LOC118943917 NA coding upstream 673843 5015646 ~ 5046380 (+)
LOC118943916 NA coding upstream 800972 4904967 ~ 4919251 (+)
LOC118943824 NA coding upstream 940749 4778594 ~ 4779474 (+)
LOC118943860 LOC106577385 coding downstream 285073 6005814 ~ 6077481 (+)
LOC110510837 LOC106577343 coding downstream 365995 6086736 ~ 6331870 (+)
LOC110511038 LOC106591983 coding downstream 619246 6339987 ~ 6367016 (+)
uros hem4 coding downstream 655883 6376624 ~ 6394234 (+)
LOC110515887 mmp21 coding downstream 677760 6398501 ~ 6414349 (+)
G1824766 NA non-coding upstream 45463 5673623 ~ 5674760 (+)
G1824763 NA non-coding upstream 50711 5665481 ~ 5669512 (+)
G1824764 NA non-coding upstream 52232 5666649 ~ 5667991 (+)
G1824733 NA non-coding upstream 112578 5597077 ~ 5607645 (+)
G1824716 NA non-coding upstream 143876 5575465 ~ 5576347 (+)
G1824788 NA non-coding downstream 5612 5726353 ~ 5729276 (+)
G1824796 NA non-coding downstream 25991 5746732 ~ 5747227 (+)
G1824806 NA non-coding downstream 40181 5760922 ~ 5762086 (+)
G1824830 NA non-coding downstream 87870 5808611 ~ 5810741 (+)
G1824850 NA non-coding downstream 139563 5860304 ~ 5861307 (+)
G1824676 LOC106593814 other upstream 233175 5478113 ~ 5487048 (+)
G1824231 LOC107579696 other upstream 892924 4826952 ~ 4827299 (+)
G1824228 NA other upstream 900655 4805496 ~ 4819568 (+)
G1823100 NA other upstream 1714900 4004299 ~ 4005323 (+)
G1822905 LOC100136344 other upstream 1805387 3900806 ~ 3918363 (+)
G1824861 NA other downstream 163062 5883803 ~ 5884315 (+)
G1825399 LOC106577407 other downstream 1163222 6883963 ~ 6886112 (+)
G1825869 NA other downstream 1515713 7236454 ~ 7236902 (+)

Expression


G1824784 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1824784 Expression in each Bioproject

Bar chart with 13 bars.
G1824784 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network