G1825658



Basic Information


Item Value
gene id G1825658
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 6823168 ~ 6825818 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2090621
GTTCACTACCGAGTTCGCTGTAAAACGTTACGCGCTGTGGCAGTGCTTCGGCTCTGGGGTTATGTTCTGTGAGTCGTGTTCTCTCCTTGTGCCTCAGTCTCTGCCCTCTCTGTGTCCATGTATGCCTGGACAGACCTCCACAGGGCTTGGATGTTCCCCTCTCCGAACCCTGACGCACCTCTCCTCTCGATTAGCTCCAGGAAGAAGGTGTCCTCTGAGAAGATGGGCTGGGTGAACGCCTGGAGCAGGTATCTGTTTAGAGGGAATGAGAAGATGGGCTTGGTGAACGCCTGGAGCAGGTATCTGTTTAGAGGGAATGAGAAGATGGGCTTGGTGAACGCCTGGAGCAGGTATCTGAGAATGAGAAGATGGGCTTGGTGAACACCTGGAGCAGGTATC

Function


NR:

description
4-hydroxyphenylpyruvate dioxygenase-like protein

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU2090621 True 399 TUCP 0.54 2 6823168 6825818

Neighbor


gene id symbol gene type direction distance location
LOC110510773 LOC106613841 coding downstream 9445 6746373 ~ 6813723 (-)
LOC110515214 bccip coding downstream 446633 6367021 ~ 6376535 (-)
LOC110514830 dock1 coding downstream 824022 5460328 ~ 5999146 (-)
LOC118943912 NA coding downstream 1317691 5503698 ~ 5505477 (-)
LOC118943897 LOC106613906 coding downstream 1397562 5423399 ~ 5425606 (-)
LOC110518105 LOC106592890 coding upstream 59536 6885354 ~ 6901189 (-)
LOC118943880 gpr26 coding upstream 571341 7397159 ~ 7409361 (-)
LOC110531557 fbx37 coding upstream 1149101 7974919 ~ 7979808 (-)
LOC110531799 LOC106577395 coding upstream 1255936 8081754 ~ 8089912 (-)
cj104 cj104 coding upstream 1273490 8099308 ~ 8104167 (-)
G1825637 NA non-coding downstream 31163 6790156 ~ 6792005 (-)
G1825635 NA non-coding downstream 35531 6784254 ~ 6787637 (-)
G1825578 NA non-coding downstream 78344 6743935 ~ 6744824 (-)
G1825599 NA non-coding downstream 124105 6698810 ~ 6699063 (-)
G1825598 NA non-coding downstream 131198 6691601 ~ 6691970 (-)
G1825660 NA non-coding upstream 3521 6829339 ~ 6829846 (-)
G1825649 NA non-coding upstream 7247 6833065 ~ 6846950 (-)
G1825661 NA non-coding upstream 13814 6839632 ~ 6840184 (-)
G1825663 NA non-coding upstream 18792 6844610 ~ 6845284 (-)
G1825664 NA non-coding upstream 21863 6847681 ~ 6847990 (-)
G1825582 NA other downstream 163217 6658118 ~ 6659951 (-)
G1825493 LOC106593079 other downstream 469147 6352088 ~ 6354021 (-)
G1825145 NA other downstream 799206 6021536 ~ 6023962 (-)
G1824605 NA other downstream 1483267 5338573 ~ 5339901 (-)
G1825645 LOC106593297 other upstream 101034 6926852 ~ 6943944 (-)
G1826079 NA other upstream 758746 7584564 ~ 7584977 (-)
G1826369 NA other upstream 1134021 7959839 ~ 7960824 (-)
G1826594 NA other upstream 1317365 8143183 ~ 8147004 (-)
G1827228 NA other upstream 2016784 8842602 ~ 8948639 (-)

Expression


G1825658 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1825658 Expression in each Bioproject

Bar chart with 14 bars.
G1825658 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network