G1825865



Basic Information


Item Value
gene id G1825865
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 7231450 ~ 7231677 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2090885
tagatgaagtgtcccctatgatttgaagggttagtagatgaagtgtcccctatgatttgaagggttagtagatgaagtgtcccctatgatttgaagggttagtagatgaagtgtcccctatgatttgaagggttagtagatgaagtgtcccctatgatttgaagggttagtagatgacgtgtcccctatgatttgaagggttagtagatgaagtgtcccctatgattt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2090885 True 228 lncRNA 0.41 1 7231450 7231677
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110518105 LOC106592890 coding downstream 330261 6885354 ~ 6901189 (-)
LOC110510773 LOC106613841 coding downstream 417727 6746373 ~ 6813723 (-)
LOC110515214 bccip coding downstream 854915 6367021 ~ 6376535 (-)
LOC110514830 dock1 coding downstream 1232304 5460328 ~ 5999146 (-)
LOC118943880 gpr26 coding upstream 165482 7397159 ~ 7409361 (-)
LOC110531557 fbx37 coding upstream 743242 7974919 ~ 7979808 (-)
LOC110531799 LOC106577395 coding upstream 850077 8081754 ~ 8089912 (-)
cj104 cj104 coding upstream 867631 8099308 ~ 8104167 (-)
LOC110515025 LOC106577347 coding upstream 1051470 8276732 ~ 8289116 (-)
G1825863 NA non-coding downstream 2729 7228508 ~ 7228721 (-)
G1825855 NA non-coding downstream 13400 7217099 ~ 7218050 (-)
G1825842 NA non-coding downstream 35081 7195356 ~ 7196369 (-)
G1825837 NA non-coding downstream 57131 7173862 ~ 7174319 (-)
G1825825 NA non-coding downstream 89288 7141781 ~ 7142162 (-)
G1825868 NA non-coding upstream 4255 7235932 ~ 7236205 (-)
G1825941 NA non-coding upstream 40183 7271860 ~ 7274509 (-)
G1825955 NA non-coding upstream 92069 7323746 ~ 7325734 (-)
G1825957 NA non-coding upstream 97570 7329247 ~ 7331592 (-)
G1825983 NA non-coding upstream 136916 7368593 ~ 7368794 (-)
G1825645 LOC106593297 other downstream 304106 6926852 ~ 6943944 (-)
G1825658 NA other downstream 405632 6823168 ~ 6825818 (-)
G1825582 NA other downstream 571499 6658118 ~ 6659951 (-)
G1825493 LOC106593079 other downstream 877429 6352088 ~ 6354021 (-)
G1825145 NA other downstream 1207488 6021536 ~ 6023962 (-)
G1826079 NA other upstream 352887 7584564 ~ 7584977 (-)
G1826369 NA other upstream 728162 7959839 ~ 7960824 (-)
G1826594 NA other upstream 911506 8143183 ~ 8147004 (-)
G1827228 NA other upstream 1610925 8842602 ~ 8948639 (-)
LOC110532987 LOC106596646 other upstream 1619256 8838876 ~ 8945963 (-)

Expression


G1825865 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1825865 Expression in each Bioproject

Bar chart with 8 bars.
G1825865 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network