G1826079



Basic Information


Item Value
gene id G1826079
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 7584564 ~ 7584977 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2091165
CATACAAGGGTATATTTATGAAGCTATACCCATACAAGGGGATATTTATGAAGCTATACCCATACAAGGGGATATGTTTAACTCTTTACCCATACAAGGGTATATTTATGAAGCTATACCCATACAAGGGGATATGTTTAACTCTTTACCCATACAAGGGTATATTTATGAAGCTATACCCATACAAGGGGATATGTTTAACTCTTTACCCATACAAGGGTATATTTATGAAGCTATACCCATACAAGGGTATATTTATGAAGCTATACCCATACAAGGGGATATGTTTAACTCTTTACCCATACAAGGGTATATTTATGAAGCTATACCCATACAAGGGGATATGTTTAACTCTTTACCCATACAAGGGTATATTTATGAAGCTATACCCATACAAGGGGATATGTTTAACTC

Function


NR:

description
PREDICTED: uncharacterized protein LOC106578406

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2091165 True 414 TUCP 0.35 1 7584564 7584977
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118943880 gpr26 coding downstream 175203 7397159 ~ 7409361 (-)
LOC110518105 LOC106592890 coding downstream 683375 6885354 ~ 6901189 (-)
LOC110510773 LOC106613841 coding downstream 770841 6746373 ~ 6813723 (-)
LOC110515214 bccip coding downstream 1208029 6367021 ~ 6376535 (-)
LOC110514830 dock1 coding downstream 1585418 5460328 ~ 5999146 (-)
LOC110531557 fbx37 coding upstream 389942 7974919 ~ 7979808 (-)
LOC110531799 LOC106577395 coding upstream 496777 8081754 ~ 8089912 (-)
cj104 cj104 coding upstream 514331 8099308 ~ 8104167 (-)
LOC110515025 LOC106577347 coding upstream 698170 8276732 ~ 8289116 (-)
LOC118943919 LOC106560865 coding upstream 705493 8290470 ~ 8303415 (-)
G1826059 NA non-coding downstream 20734 7563489 ~ 7563830 (-)
G1826036 NA non-coding downstream 47841 7536524 ~ 7536723 (-)
G1826034 NA non-coding downstream 56439 7527922 ~ 7528125 (-)
G1826020 NA non-coding downstream 125008 7459111 ~ 7459556 (-)
G1826018 NA non-coding downstream 129710 7454248 ~ 7454854 (-)
G1826082 NA non-coding upstream 5612 7590589 ~ 7590835 (-)
G1826090 NA non-coding upstream 11896 7596873 ~ 7597551 (-)
G1826091 NA non-coding upstream 12774 7597751 ~ 7598062 (-)
G1826092 NA non-coding upstream 14509 7599486 ~ 7599768 (-)
G1826103 NA non-coding upstream 28408 7613385 ~ 7613762 (-)
G1825645 LOC106593297 other downstream 657220 6926852 ~ 6943944 (-)
G1825658 NA other downstream 758746 6823168 ~ 6825818 (-)
G1825582 NA other downstream 924613 6658118 ~ 6659951 (-)
G1825493 LOC106593079 other downstream 1230543 6352088 ~ 6354021 (-)
G1825145 NA other downstream 1560602 6021536 ~ 6023962 (-)
G1826369 NA other upstream 374862 7959839 ~ 7960824 (-)
G1826594 NA other upstream 558206 8143183 ~ 8147004 (-)
G1827228 NA other upstream 1257625 8842602 ~ 8948639 (-)
LOC110532987 LOC106596646 other upstream 1265956 8838876 ~ 8945963 (-)
jakmip3 LOC106577179 other upstream 1527580 9049200 ~ 9133856 (-)

Expression


G1826079 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1826079 Expression in each Bioproject

Bar chart with 4 bars.
G1826079 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network