G1826761


Basic Information

Item Value
gene id G1826761
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 8538900 ~ 8539519 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2092066
ATGACATTTAGGAATACAGCTGATCGGACTGGAACCATGACATTTAGGAATACAGCTGATTGGACTGGAACCATGACATTTAGGAGTACAGCTGATCGGACTGGAACCATGACATTTAGGAATACAGCTGATTGGACTGGAACCATGACATTTAGGACTGGAACCATGACATTTAGGAATACAGCTGATCGGACTGGAACCATGACATTTAGGAATACAGCTGATTGGACTGGAACCATGACATTTAGGAATACAGCTGATTGGACTGGAACCATCACATTTAGGAATACAGCTGATTGGACTGGAACCATGACATTTAGGAATACAGCTGATTGGACTGGAACCATGACATTTAGGACTGGAACCATGACATTTAGGAATACAGCTGATTGGACTGGAACCATGACATTTAGGAATACAGCTGATCGGACTGGAACCATGACATTTAGGAATACAGCTGATCGGACTGGAACCATGACATTTAGGACTGGAACCATGACATTTAGGAGTAC

Function

NR:

description
PREDICTED: shematrin-like protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2092066 True 512 TUCP 0.43 2 8538900 8539519

Neighbor

gene id symbol gene type direction distance location
LOC110516810 pald1 coding upstream 57597 8320876 ~ 8481303 (+)
LOC110515875 spock2 coding upstream 260566 8165316 ~ 8278334 (+)
LOC118943830 LOC106592879 coding upstream 384729 8104260 ~ 8154171 (+)
LOC110515096 djb12 coding upstream 458059 8065011 ~ 8080841 (+)
LOC110513904 LOC106597856 coding upstream 483491 8025503 ~ 8055409 (+)
LOC118943826 LOC106577384 coding downstream 176396 8715915 ~ 8728661 (+)
LOC110531721 LOC106595486 coding downstream 290686 8829711 ~ 8904592 (+)
LOC110517148 LOC106564289 coding downstream 335698 8875217 ~ 8898772 (+)
LOC110531732 LOC106564289 coding downstream 393155 8932674 ~ 8952352 (+)
LOC110531701 LOC106592262 coding downstream 420048 8959567 ~ 8982682 (+)
G1826758 NA non-coding upstream 4760 8533529 ~ 8534140 (+)
G1826725 NA non-coding upstream 21065 8459050 ~ 8517835 (+)
G1826672 NA non-coding upstream 54147 8481903 ~ 8484753 (+)
G1826732 NA non-coding upstream 68619 8467164 ~ 8470281 (+)
G1826762 NA non-coding downstream 190 8539709 ~ 8613818 (+)
G1826770 NA non-coding downstream 36430 8575949 ~ 8579186 (+)
G1826776 NA non-coding downstream 37246 8576765 ~ 8580002 (+)
G1826790 NA non-coding downstream 85138 8624657 ~ 8625286 (+)
G1826805 NA non-coding downstream 121572 8661091 ~ 8662681 (+)
G1826455 NA other upstream 397224 8139581 ~ 8141676 (+)
G1826407 NA other upstream 517986 8020361 ~ 8020914 (+)
G1825869 NA other upstream 1301998 7236454 ~ 7236902 (+)
G1825399 LOC106577407 other upstream 1652788 6883963 ~ 6886112 (+)
G1827033 NA other downstream 219308 8758683 ~ 8764786 (+)
G1827034 NA other downstream 219861 8759380 ~ 8760274 (+)
LOC118943850 LOC106560822 other downstream 623740 9161595 ~ 9174397 (+)
G1827493 NA other downstream 889225 9428744 ~ 9430132 (+)

Expression

G1826761 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1826761 Expression in each Bioproject

Bar chart with 17 bars.
G1826761 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network