G1828757



Basic Information


Item Value
gene id G1828757
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 10752980 ~ 10753653 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2094610
gtgaatctaagtgtgtgttctctaattctctctctttctttctctctctcggaggacctgagccctaggaccatgccccaggaatacctgacatgatgactccttgctgtccccagtccatctgactgtgctgctgctccagtttcaactgttctgccttattattattcgaccatgctggtcatttatgaacatttgaacatcttgaccatgttctgttataatctccacccggcacagccagaagaggactggccaccccacatagcctggttcctctctaggtttcttcctaggttttggcctttctagggagtttttcctagtcaccgtgcttctacacctgcaatgcttgctgtttggggttttaggctgggtttctgtacagcactttgagatatcagctgatgtacgaagggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2094610 True 420 lncRNA 0.48 2 10752980 10753653

Neighbor


gene id symbol gene type direction distance location
LOC110502253 LOC106604458 coding upstream 246401 10491410 ~ 10506579 (+)
LOC110502256 NA coding upstream 258688 10492769 ~ 10494292 (+)
LOC118943896 NA coding upstream 313642 10432931 ~ 10439338 (+)
LOC110502264 tiar coding upstream 511070 10219797 ~ 10241910 (+)
LOC110531625 LOC106577355 coding upstream 788646 9957640 ~ 9964334 (+)
LOC110502251 hps6 coding downstream 169906 10923559 ~ 10930057 (+)
LOC110502248 pprc1 coding downstream 277109 11030762 ~ 11070120 (+)
oga mgea5 coding downstream 326687 11080340 ~ 11111754 (+)
npm3 npm3 coding downstream 359943 11113596 ~ 11116281 (+)
zdhhc16a LOC106604325 coding downstream 437941 11191594 ~ 11206167 (+)
G1828247 NA non-coding upstream 358895 10393646 ~ 10394085 (+)
G1828243 NA non-coding upstream 363366 10389370 ~ 10389614 (+)
G1828241 NA non-coding upstream 367252 10383208 ~ 10385728 (+)
G1828239 NA non-coding upstream 371285 10381409 ~ 10381695 (+)
G1828238 NA non-coding upstream 371815 10380965 ~ 10381165 (+)
G1828763 NA non-coding downstream 3324 10756977 ~ 10757180 (+)
G1828828 NA non-coding downstream 46794 10800447 ~ 10800845 (+)
G1828957 NA non-coding downstream 144929 10898582 ~ 10898832 (+)
G1828959 NA non-coding downstream 146136 10899789 ~ 10900057 (+)
G1828962 NA non-coding downstream 148360 10902013 ~ 10903790 (+)
G1828208 LOC106604487 other upstream 350809 10394478 ~ 10402171 (+)
G1828033 NA other upstream 686668 10035682 ~ 10066312 (+)
G1827493 NA other upstream 1322848 9428744 ~ 9430132 (+)
LOC118943850 LOC106560822 other upstream 1578586 9161595 ~ 9174397 (+)
G1829089 NA other downstream 458044 11211697 ~ 11220145 (+)
G1829147 NA other downstream 523224 11276877 ~ 11278445 (+)
G1829155 NA other downstream 533837 11287490 ~ 11288151 (+)
G1830068 NA other downstream 1104588 11858241 ~ 11858662 (+)

Expression


G1828757 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1828757 Expression in each Bioproject

Bar chart with 19 bars.
G1828757 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network