G1830115



Basic Information


Item Value
gene id G1830115
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 11884994 ~ 11885280 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2096067
tccatttcaatattattgcttgcacaatgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaactctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2096067 True 211 lncRNA 0.38 2 11884994 11885280

Neighbor


gene id symbol gene type direction distance location
LOC118943913 drgx coding downstream 77144 11798161 ~ 11807866 (-)
LOC110502235 LOC106604231 coding downstream 119428 11734088 ~ 11765566 (-)
LOC110502237 LOC106604271 coding downstream 338300 11529791 ~ 11546694 (-)
LOC110502238 arhgap22 coding downstream 369011 11494157 ~ 11515983 (-)
LOC110503077 LOC106576846 coding downstream 557288 11297727 ~ 11327706 (-)
LOC110502234 LOC106604225 coding upstream 22547 11907827 ~ 11953940 (-)
znf511 NA coding upstream 209588 12094868 ~ 12098744 (-)
LOC110502230 LOC106604182 coding upstream 229819 12115099 ~ 12175948 (-)
LOC110502229 NA coding upstream 296258 12181538 ~ 12205662 (-)
LOC110503075 LOC105010677 coding upstream 334377 12219657 ~ 12254247 (-)
G1830077 NA non-coding downstream 21888 11862849 ~ 11863106 (-)
G1830073 NA non-coding downstream 23044 11861733 ~ 11861950 (-)
G1830072 NA non-coding downstream 23427 11861336 ~ 11861567 (-)
G1830069 NA non-coding downstream 26193 11858247 ~ 11858801 (-)
G1830058 NA non-coding downstream 31971 11852767 ~ 11853023 (-)
G1830184 NA non-coding upstream 10732 11896012 ~ 11896795 (-)
G1830182 NA non-coding upstream 26189 11911469 ~ 11913359 (-)
G1830228 NA non-coding upstream 76030 11961310 ~ 11961552 (-)
G1830238 NA non-coding upstream 81075 11966355 ~ 11966607 (-)
G1830239 NA non-coding upstream 81800 11967080 ~ 11967282 (-)
G1829918 NA other downstream 151068 11733430 ~ 11733926 (-)
G1829417 LOC106604325 other downstream 680998 11203067 ~ 11203996 (-)
G1827761 NA other downstream 2196150 9688457 ~ 9688844 (-)
G1827690 NA other downstream 2340021 9544383 ~ 9544973 (-)
LOC110502269 LOC106604550 other upstream 507683 12392924 ~ 12411810 (-)
LOC110502275 LOC106604599 other upstream 695536 12580816 ~ 12651383 (-)
G1833570 NA other upstream 2635069 14520349 ~ 14520929 (-)
G1834810 NA other upstream 3280929 15166209 ~ 15166919 (-)

Expression


G1830115 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1830115 Expression in each Bioproject

Bar chart with 9 bars.
G1830115 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1750.
End of interactive chart.

Co-expression Network