G1831222



Basic Information


Item Value
gene id G1831222
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 12806794 ~ 12807157 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2097348
ggaagacatccttctccctcatgtggtacccttcctgtaggctcatcctgacatgaccctccagcatgacaatgtcaccagccatactgctcgttctgtgtgtgatttcctgcaagacaggaatgtcagtgttctgccatggtcagcgaggagcccagatctcaatcccattcagcacgtctgggacctgttggatcggagggtgagggctagggccattccccccagaaatgtctgggaacttgcaggtgccttggtggaagagtggggtaacatctcacagcaagaactggcaaatctggtgcagtccatgatgaggagatgcactgcagtacttattgcagctggtggccacactagacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2097348 True 364 TUCP 0.54 1 12806794 12807157
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502277 fam204a coding upstream 59437 12729848 ~ 12747359 (+)
pcbd1 phs coding upstream 295622 12508239 ~ 12511172 (+)
LOC110502228 ap3m1 coding upstream 530586 12257815 ~ 12276208 (+)
wdfy4 wdfy4 coding upstream 1080347 11546873 ~ 11726447 (+)
LOC110502239 mapk8 coding upstream 1310679 11462277 ~ 11496115 (+)
LOC110502278 rab11fip2 coding downstream 20496 12827653 ~ 12864115 (+)
LOC110502282 LOC106604714 coding downstream 277430 13084587 ~ 13097908 (+)
LOC110502286 prdx3 coding downstream 312194 13119351 ~ 13122667 (+)
LOC110502289 LOC106604759 coding downstream 367192 13174349 ~ 13178371 (+)
LOC110502290 LOC106604744 coding downstream 390594 13197751 ~ 13213023 (+)
G1831189 NA non-coding upstream 50471 12756109 ~ 12756323 (+)
G1831187 NA non-coding upstream 52780 12753705 ~ 12754014 (+)
G1831185 NA non-coding upstream 53729 12751694 ~ 12753065 (+)
G1831047 NA non-coding upstream 153786 12652788 ~ 12653008 (+)
G1831228 NA non-coding downstream 6957 12814114 ~ 12814362 (+)
G1831230 NA non-coding downstream 14945 12822102 ~ 12822355 (+)
G1831438 NA non-coding downstream 146858 12954015 ~ 12954531 (+)
G1831441 NA non-coding downstream 148447 12955604 ~ 12956262 (+)
G1831035 NA other upstream 169630 12636472 ~ 12637164 (+)
G1831003 NA other upstream 215965 12589467 ~ 12590829 (+)
G1830449 NA other upstream 498828 12307566 ~ 12307966 (+)
G1830301 NA other upstream 740845 12062979 ~ 12065949 (+)
G1831809 NA other downstream 686405 13493562 ~ 13493965 (+)
LOC110503083 LOC106605092 other downstream 2910654 15717449 ~ 15743397 (+)
G1834634 NA other downstream 2954156 15761313 ~ 15761582 (+)
G1835378 NA other downstream 3388011 16195168 ~ 16202860 (+)
LOC110502340 kcng3 other downstream 3713842 16519036 ~ 16528382 (+)

Expression


G1831222 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1831222 Expression in each Bioproject

Bar chart with 21 bars.
G1831222 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network