G1836472



Basic Information


Item Value
gene id G1836472
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 16971559 ~ 16972774 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2103027
agttaatactttgtagcaccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgatggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggcttcatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaaatttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatatgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacgaccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtagccaaatccggctttaaacttcttcacaacagtttctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaagtaattttgcacgcccaatttttcag

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2103027 True 1216 lncRNA 0.43 1 16971559 16972774
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502346 pkdcc coding downstream 47580 16891354 ~ 16923979 (-)
LOC110502345 eml4 coding downstream 207517 16673409 ~ 16764042 (-)
LOC118943947 NA coding downstream 325127 16646380 ~ 16646432 (-)
trnai-uau-47 NA coding downstream 595586 16375880 ~ 16375973 (-)
LOC110502333 LOC102778633 coding downstream 1102508 15865071 ~ 15869051 (-)
LOC110502348 LOC106605759 coding upstream 54975 17027749 ~ 17096659 (-)
LOC110503085 NA coding upstream 94504 17067278 ~ 17077857 (-)
LOC110502353 LOC106605805 coding upstream 447549 17420323 ~ 17425430 (-)
LOC110502354 ncoa4 coding upstream 471700 17444474 ~ 17453469 (-)
LOC118943816 NA coding upstream 481932 17454706 ~ 17471690 (-)
G1836470 NA non-coding downstream 2080 16969274 ~ 16969479 (-)
G1836466 NA non-coding downstream 4985 16966288 ~ 16966574 (-)
G1836461 NA non-coding downstream 9914 16961221 ~ 16961645 (-)
G1836447 NA non-coding downstream 28351 16942981 ~ 16943208 (-)
G1836445 NA non-coding downstream 29963 16941359 ~ 16941596 (-)
G1836473 NA non-coding upstream 174 16972948 ~ 16973200 (-)
G1836607 NA non-coding upstream 87826 17060600 ~ 17063934 (-)
G1836631 NA non-coding upstream 124902 17097676 ~ 17097899 (-)
G1836633 NA non-coding upstream 127327 17100101 ~ 17100840 (-)
G1835092 NA other downstream 1223824 15745638 ~ 15747735 (-)
tmem254 cj057 other downstream 1300379 15666203 ~ 15671223 (-)
G1834927 NA other downstream 1471298 15498754 ~ 15500261 (-)
G1834810 NA other downstream 1804640 15166209 ~ 15166919 (-)
G1833570 NA other downstream 2450630 14520349 ~ 14520929 (-)
G1837980 NA other upstream 736998 17709772 ~ 17719204 (-)
LOC110502361 LOC106605890 other upstream 752489 17725263 ~ 17781515 (-)
LOC110502394 LOC106606249 other upstream 1876923 18849389 ~ 18854222 (-)
si:dkey-51a16.9 LOC106576688 other upstream 2139268 19111958 ~ 19145332 (-)

Expression


G1836472 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1836472 Expression in each Bioproject

Bar chart with 20 bars.
G1836472 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network