G1846858



Basic Information


Item Value
gene id G1846858
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 25439807 ~ 25440387 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2114269
gttttggggctgttgctgggcaacacagactttcagctccctccaaagattttctatggggttgagatctggagactggctaggccactccaggaccttgaaatgcttcttacgaagccactccttcattgcccgggcggtgtgttttggatcattgtcatgctgaaagacccagccacgtttcatcttcaatgcccttgcagatggaaggaggttttcactcaaaatctcacgatacatggccccattcattctttcctttacacggatcattcgtcctggtccctttgcagaaaaacagccccaaagcatgatgtttccacccccatgcttcacagtaggtatggtattctttggatgcaactcagcattctttgtcctccaaacacgacgagttgagtttttaccaaaaagttatattttggtttcatctgaccatatgacattctcccaatcttcttctggatcatccaaatgctctctagaaaaacttcagacgggcctggacatgtactggcttaagcagggggacacatctggcactgcaggatttgagtccctgtcggtgtagtgtgttactg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2114269 True 581 TUCP 0.47 1 25439807 25440387

Neighbor


gene id symbol gene type direction distance location
LOC110503059 NA coding downstream 21208 25417364 ~ 25418599 (-)
LOC110502487 LOC106607391 coding downstream 247482 25131256 ~ 25192325 (-)
gnrh1 gnrh1 coding downstream 310856 25127611 ~ 25128951 (-)
LOC118943844 NA coding downstream 593603 24839909 ~ 24846204 (-)
LOC110502483 LOC106607298 coding downstream 626449 24806973 ~ 24813358 (-)
LOC110503093 NA coding upstream 262869 25703256 ~ 25704420 (-)
LOC110503094 edrf1 coding upstream 288101 25728488 ~ 25735408 (-)
LOC110502495 zranb1 coding upstream 444569 25884956 ~ 25932474 (-)
LOC110502496 fam175b coding upstream 499339 25939726 ~ 25947986 (-)
LOC110502501 gpr26 coding upstream 786243 26226630 ~ 26230546 (-)
G1846848 NA non-coding downstream 14476 25425083 ~ 25425331 (-)
G1846847 NA non-coding downstream 15514 25424094 ~ 25424293 (-)
G1846753 NA non-coding downstream 85875 25288246 ~ 25353932 (-)
G1846716 NA non-coding downstream 181017 25221172 ~ 25258790 (-)
G1846525 NA non-coding downstream 238667 25200796 ~ 25201140 (-)
G1846866 NA non-coding upstream 7773 25448160 ~ 25448430 (-)
G1846868 NA non-coding upstream 10948 25451335 ~ 25451585 (-)
G1846901 NA non-coding upstream 65283 25505670 ~ 25505898 (-)
G1846927 NA non-coding upstream 81883 25522270 ~ 25522916 (-)
G1846928 NA non-coding upstream 82698 25523085 ~ 25523365 (-)
LOC110502462 LOC106607169 other downstream 2094036 23344353 ~ 23358461 (-)
G1843946 NA other downstream 2206384 23182987 ~ 23233423 (-)
LOC110502461 LOC106607165 other downstream 2221537 23213905 ~ 23218749 (-)
G1841959 NA other downstream 4068008 21345514 ~ 21371799 (-)
G1841694 NA other downstream 4496192 20943307 ~ 20943615 (-)
G1850441 NA other upstream 2634538 28074925 ~ 28078251 (-)
LOC110502553 NA other upstream 3484352 28919846 ~ 28932600 (-)
LOC110502574 LOC106608078 other upstream 5711222 31151609 ~ 31239202 (-)
G1854905 NA other upstream 5777210 31217597 ~ 31218171 (-)
G1855326 NA other upstream 6539610 31979997 ~ 31981333 (-)

Expression


G1846858 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1846858 Expression in each Bioproject

Bar chart with 20 bars.
G1846858 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network