G1848704



Basic Information


Item Value
gene id G1848704
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 26611216 ~ 26624631 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2116208
gttttgcattgttgccaaaaagttcaattttgaccatctgaccagagcaccttcttacacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatatgactgactcttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2116208 True 385 lncRNA 0.44 2 26611216 26624631
Loading

Neighbor


gene id symbol gene type direction distance location
cuzd1.2 LOC106607512 coding downstream 145326 26457010 ~ 26465890 (-)
LOC110502503 hmx3 coding downstream 204662 26403613 ~ 26406554 (-)
LOC110502502 hmx2 coding downstream 213083 26387522 ~ 26398133 (-)
LOC110502501 gpr26 coding downstream 380670 26226630 ~ 26230546 (-)
LOC110502496 fam175b coding downstream 663230 25939726 ~ 25947986 (-)
LOC110502513 LOC106607606 coding upstream 649921 27252967 ~ 27310171 (-)
LOC110502517 LOC106607615 coding upstream 799261 27423892 ~ 27435842 (-)
si:ch211-248a14.8 LOC106608780 coding upstream 824991 27449622 ~ 27453880 (-)
LOC110502526 LOC106607693 coding upstream 1225473 27850104 ~ 27859306 (-)
LOC110502525 LOC106607696 coding upstream 1235461 27860092 ~ 27983425 (-)
G1848675 NA non-coding downstream 23977 26577284 ~ 26587239 (-)
G1848261 NA non-coding downstream 64846 26544808 ~ 26546370 (-)
G1848203 NA non-coding downstream 143014 26467965 ~ 26468202 (-)
G1848195 NA non-coding downstream 163375 26446243 ~ 26447841 (-)
G1848183 NA non-coding downstream 183709 26427254 ~ 26427507 (-)
G1849386 NA non-coding upstream 657682 27282313 ~ 27282533 (-)
G1849390 NA non-coding upstream 659838 27284469 ~ 27284774 (-)
G1849397 NA non-coding upstream 665469 27290100 ~ 27290326 (-)
G1849410 NA non-coding upstream 692788 27317419 ~ 27317619 (-)
G1846858 NA other downstream 1170829 25439807 ~ 25440387 (-)
LOC110502462 LOC106607169 other downstream 3265445 23344353 ~ 23358461 (-)
G1843946 NA other downstream 3377793 23182987 ~ 23233423 (-)
LOC110502461 LOC106607165 other downstream 3392946 23213905 ~ 23218749 (-)
G1841959 NA other downstream 5239417 21345514 ~ 21371799 (-)
G1850441 NA other upstream 1450294 28074925 ~ 28078251 (-)
LOC110502553 NA other upstream 2300108 28919846 ~ 28932600 (-)
LOC110502574 LOC106608078 other upstream 4526978 31151609 ~ 31239202 (-)
G1854905 NA other upstream 4592966 31217597 ~ 31218171 (-)
G1855326 NA other upstream 5355366 31979997 ~ 31981333 (-)

Expression


G1848704 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1848704 Expression in each Bioproject

Bar chart with 13 bars.
G1848704 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network