G1852573



Basic Information


Item Value
gene id G1852573
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 29884415 ~ 29884633 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2120325
gatctactgtctcttttatattatgacatttcagctagatctactgtctttattatattacaacagaccagctgtatctactgtctccatttcactttggccattgatgtggtcctgccctctcctcaacagcctcaaataggctatttcatgtgggttggggtggggcggcagacacacgcatctcacatttcatgacattacatgtttatatattgc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2120325 True 219 lncRNA 0.42 1 29884415 29884633
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118943859 NA coding upstream 267845 29613252 ~ 29616570 (+)
LOC110502556 NA coding upstream 749562 29131643 ~ 29134853 (+)
LOC110502552 tsn14 coding upstream 967009 28901697 ~ 28917406 (+)
LOC110502551 LOC106607927 coding upstream 1060621 28818971 ~ 28823794 (+)
LOC110502550 LOC106607923 coding upstream 1087553 28793894 ~ 28796862 (+)
si:ch1073-126c3.2 NA coding downstream 108964 29993597 ~ 29995811 (+)
gfra1a rtgfra1 coding downstream 158894 30043527 ~ 30144813 (+)
LOC110502560 LOC106607954 coding downstream 700263 30547124 ~ 30659333 (+)
LOC110502563 LOC106607969 coding downstream 781911 30666544 ~ 30682724 (+)
LOC110502565 LOC106607988 coding downstream 843755 30728388 ~ 30816688 (+)
G1852323 NA non-coding upstream 62992 29737885 ~ 29821423 (+)
G1852258 LOC100380853 non-coding upstream 225166 29659021 ~ 29659249 (+)
G1852257 NA non-coding upstream 226528 29657637 ~ 29657887 (+)
G1852250 NA non-coding upstream 228703 29655406 ~ 29655712 (+)
G1851756 NA non-coding upstream 285049 29558798 ~ 29599366 (+)
G1852628 NA non-coding downstream 79588 29964221 ~ 29964445 (+)
G1852630 NA non-coding downstream 80253 29964886 ~ 29965183 (+)
G1852631 NA non-coding downstream 82226 29966859 ~ 29967132 (+)
G1852632 NA non-coding downstream 82580 29967213 ~ 29967421 (+)
G1853031 NA non-coding downstream 712802 30597435 ~ 30600086 (+)
G1851386 NA other upstream 808417 29043361 ~ 29075998 (+)
LOC110502541 LOC106607837 other upstream 1359178 28497576 ~ 28571528 (+)
LOC110502528 bic1a other upstream 1878201 28001291 ~ 28078254 (+)
LOC110502527 LOC106607701 other upstream 1891452 27990245 ~ 27993189 (+)
G1849208 LOC106607606 other upstream 2608156 27274338 ~ 27276259 (+)
G1852590 NA other downstream 133857 30018490 ~ 30025046 (+)
G1853092 NA other downstream 920917 30805550 ~ 30806454 (+)
G1853162 rps27a other downstream 941952 30826585 ~ 30834692 (+)
LOC110502584 LOC106608814 other downstream 1735784 31620398 ~ 31624184 (+)

Expression


G1852573 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1852573 Expression in each Bioproject

Bar chart with 20 bars.
G1852573 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network