G1853097



Basic Information


Item Value
gene id G1853097
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 30708753 ~ 30709917 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2120884
ACATAACATTGTGTACCTTATTTCCATGATGGTGGCAGTGTAAACAGCACCAAACTCCAGCAGCTGCTCTTGATCATCCTTGCAGATTTCTGTGACGAATTCCTGGGCTTCATTCATTGCACCTGGAGTAGGTGCAAACACAGAGAAGGTCTCCTCGTCCACCTGGCTTATCGTCACACCTATCCAATGAC

Function


NR:

description
polyribonucleotide nucleotidyltransferase 1, mitochondrial-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2120884 True 191 lncRNA 0.47 2 30708753 30709917
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502563 LOC106607969 coding upstream 26029 30666544 ~ 30682724 (+)
LOC110502560 LOC106607954 coding upstream 49420 30547124 ~ 30659333 (+)
gfra1a rtgfra1 coding upstream 563940 30043527 ~ 30144813 (+)
si:ch1073-126c3.2 NA coding upstream 712942 29993597 ~ 29995811 (+)
LOC118943859 NA coding upstream 1092183 29613252 ~ 29616570 (+)
LOC110502565 LOC106607988 coding downstream 18471 30728388 ~ 30816688 (+)
LOC110502570 rtn10 coding downstream 164893 30874810 ~ 30909320 (+)
LOC110502572 LOC106608074 coding downstream 479433 31189350 ~ 31192215 (+)
LOC110502577 LOC106608097 coding downstream 646530 31356447 ~ 31380224 (+)
LOC110502579 LOC106608126 coding downstream 750752 31460669 ~ 31482046 (+)
G1853031 NA non-coding upstream 108667 30597435 ~ 30600086 (+)
G1852632 NA non-coding upstream 741332 29967213 ~ 29967421 (+)
G1852631 NA non-coding upstream 741621 29966859 ~ 29967132 (+)
G1852630 NA non-coding upstream 743570 29964886 ~ 29965183 (+)
G1852628 NA non-coding upstream 744308 29964221 ~ 29964445 (+)
G1853099 LOC106607983 non-coding downstream 5169 30715086 ~ 30716130 (+)
G1853156 NA non-coding downstream 109096 30819013 ~ 30819225 (+)
G1853161 NA non-coding downstream 115150 30825067 ~ 30825321 (+)
G1853162 rps27a non-coding downstream 116668 30826585 ~ 30834692 (+)
G1853168 NA non-coding downstream 127686 30837603 ~ 30837806 (+)
G1852590 NA other upstream 683707 30018490 ~ 30025046 (+)
G1851386 NA other upstream 1632755 29043361 ~ 29075998 (+)
LOC110502541 LOC106607837 other upstream 2183516 28497576 ~ 28571528 (+)
LOC110502528 bic1a other upstream 2702539 28001291 ~ 28078254 (+)
G1853092 NA other downstream 95633 30805550 ~ 30806454 (+)
LOC110502584 LOC106608814 other downstream 910500 31620398 ~ 31624184 (+)
morn2 morn2 other downstream 1157947 31866319 ~ 31869743 (+)
LOC110502602 LOC106608363 other downstream 1792452 32489267 ~ 32530254 (+)

Expression


G1853097 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1853097 Expression in each Bioproject

Bar chart with 9 bars.
G1853097 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network